ID: 1196706399

View in Genome Browser
Species Human (GRCh38)
Location X:118721145-118721167
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196706392_1196706399 12 Left 1196706392 X:118721110-118721132 CCAGGGTGGGGAAAGTGCAGTGA No data
Right 1196706399 X:118721145-118721167 GGATCCTGGCTAAGATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196706399 Original CRISPR GGATCCTGGCTAAGATGCCA GGG Intergenic
No off target data available for this crispr