ID: 1196733471

View in Genome Browser
Species Human (GRCh38)
Location X:118963869-118963891
Sequence CAGTGACCCCCATGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196733471_1196733483 30 Left 1196733471 X:118963869-118963891 CCCACATCCCATGGGGGTCACTG No data
Right 1196733483 X:118963922-118963944 TGGGAGTGGAGTTGCCTGTCAGG No data
1196733471_1196733479 16 Left 1196733471 X:118963869-118963891 CCCACATCCCATGGGGGTCACTG No data
Right 1196733479 X:118963908-118963930 TTGAGCTCAGCCCCTGGGAGTGG No data
1196733471_1196733476 10 Left 1196733471 X:118963869-118963891 CCCACATCCCATGGGGGTCACTG No data
Right 1196733476 X:118963902-118963924 GTGACCTTGAGCTCAGCCCCTGG No data
1196733471_1196733477 11 Left 1196733471 X:118963869-118963891 CCCACATCCCATGGGGGTCACTG No data
Right 1196733477 X:118963903-118963925 TGACCTTGAGCTCAGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196733471 Original CRISPR CAGTGACCCCCATGGGATGT GGG (reversed) Intergenic
No off target data available for this crispr