ID: 1196734981

View in Genome Browser
Species Human (GRCh38)
Location X:118975200-118975222
Sequence GACGGGGGCCGCCGCGGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 444}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196734969_1196734981 22 Left 1196734969 X:118975155-118975177 CCCGGACGAGGGTAGCACTGCAA 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG 0: 1
1: 0
2: 0
3: 36
4: 444
1196734977_1196734981 -7 Left 1196734977 X:118975184-118975206 CCGTGGCGGCGGAAGAGACGGGG 0: 1
1: 0
2: 1
3: 8
4: 108
Right 1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG 0: 1
1: 0
2: 0
3: 36
4: 444
1196734966_1196734981 30 Left 1196734966 X:118975147-118975169 CCGGCGCCCCCGGACGAGGGTAG 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG 0: 1
1: 0
2: 0
3: 36
4: 444
1196734970_1196734981 21 Left 1196734970 X:118975156-118975178 CCGGACGAGGGTAGCACTGCAAG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG 0: 1
1: 0
2: 0
3: 36
4: 444
1196734968_1196734981 23 Left 1196734968 X:118975154-118975176 CCCCGGACGAGGGTAGCACTGCA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG 0: 1
1: 0
2: 0
3: 36
4: 444
1196734967_1196734981 24 Left 1196734967 X:118975153-118975175 CCCCCGGACGAGGGTAGCACTGC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG 0: 1
1: 0
2: 0
3: 36
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196734981 Original CRISPR GACGGGGGCCGCCGCGGCTG CGG Exonic
900191766 1:1355136-1355158 GGCGGGGGTGGCCGGGGCTGCGG + Exonic
900233504 1:1574795-1574817 GCCGGGGGCCGGCGCGGCGTTGG - Exonic
900284093 1:1891018-1891040 GACGGAGGCGGCGGCGGCGGCGG - Exonic
901210806 1:7525068-7525090 GACGGGGGCCGACGCGGGGGCGG - Intronic
901331211 1:8410203-8410225 GAGGGGGGCCGCCCTGGCTGGGG + Intronic
901686440 1:10946134-10946156 GACGGCGGCCCCCACGCCTGGGG - Intergenic
902350108 1:15847959-15847981 GGCGGCGGCGGCGGCGGCTGCGG - Exonic
902600873 1:17539654-17539676 GTCCCGGGGCGCCGCGGCTGAGG - Intergenic
902823238 1:18956232-18956254 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
903398294 1:23019611-23019633 GAAGGCGGCAGCCGCGGCGGCGG + Exonic
903750582 1:25618051-25618073 GCCCGGGGCCGGCGCGGCGGGGG - Exonic
903777138 1:25800346-25800368 GACGGCGGCGGCAGCGGCGGCGG - Exonic
904006596 1:27366329-27366351 TGCGGGGGCGGCCGCGGCCGGGG + Exonic
904701578 1:32361554-32361576 GACAGGGGCCGCTGAGGCAGGGG + Intronic
904782934 1:32964397-32964419 GGCGGAGGCCGCGGCGGCGGCGG - Exonic
904859204 1:33522135-33522157 GTCTGGGGCCGCAGCGGCTGAGG + Intronic
906169015 1:43707898-43707920 GGTGGGGGCCGCCGAGCCTGGGG + Intronic
907038335 1:51236356-51236378 GGCGGGGGCAGCAGCAGCTGAGG + Exonic
907126625 1:52056281-52056303 GACGGCGGCGGCGGCGGCGGCGG - Exonic
907341541 1:53739170-53739192 GGCGGCGGCTGCGGCGGCTGCGG - Intergenic
907341543 1:53739179-53739201 GGCGGCGGCGGCGGCGGCTGCGG - Intergenic
908355809 1:63323931-63323953 GGCGGCGGCCGCGGCTGCTGCGG + Exonic
911612239 1:99970036-99970058 GACGGGAGCCGGCGGCGCTGCGG + Intronic
913323201 1:117605338-117605360 GAATGGGGCCGAAGCGGCTGCGG + Intergenic
914803234 1:150974971-150974993 GACGGGCGTGGACGCGGCTGTGG - Exonic
915495965 1:156282763-156282785 GCCGGTGGCGGCGGCGGCTGCGG - Exonic
916507966 1:165445154-165445176 GACGGCGGCGGCGGCGGCGGCGG - Exonic
917345154 1:174022045-174022067 GAGCGGGGCTGCCGCGGCCGGGG - Intronic
917345179 1:174022148-174022170 GGCGGCGGCTGCCGCGGCGGTGG - Exonic
917817636 1:178725967-178725989 GGCGGGGGCCGCTCGGGCTGCGG - Intronic
919678484 1:200409951-200409973 GACGGCGGCTGCGGCGGCGGCGG - Exonic
920309964 1:205043233-205043255 GGCGGCGGCCGCGGCGGCGGTGG - Exonic
922558195 1:226548931-226548953 GACGGCGGCGGCGGCGGCGGCGG + Exonic
922776781 1:228218262-228218284 GACAGGGTCCGCCTAGGCTGGGG + Intronic
923665173 1:235992975-235992997 GACTGGGGACGCTGAGGCTGGGG + Intronic
924052802 1:240093678-240093700 GTCTGGGGCCCCCGCGGCTGCGG + Exonic
924436780 1:244049175-244049197 GGCGGGGGGCGGCGCAGCTGCGG + Intronic
924563125 1:245173600-245173622 GACGCGGGCCGGGGAGGCTGTGG + Intronic
1062916086 10:1242082-1242104 GAAGGCGGACGCCGCGGCTGGGG - Intronic
1063407747 10:5813195-5813217 GACGGTGGGCGCCAGGGCTGAGG - Exonic
1063660866 10:8034499-8034521 GACGGGGGCGGCGGAGGGTGTGG + Intergenic
1064086505 10:12349648-12349670 GACCGCGGCCGCGGCGGCGGCGG + Exonic
1065250221 10:23803374-23803396 GACGGGGGCTGCCCCTGGTGTGG - Intronic
1065520578 10:26567304-26567326 GACGGGGGCGGGCGCGGGCGCGG - Exonic
1067498091 10:46776371-46776393 GGCGGGGGCCCGCGCAGCTGGGG + Intergenic
1067596555 10:47564043-47564065 GGCGGGGGCCCGCGCAGCTGGGG - Intergenic
1070032619 10:72692209-72692231 GGCGGGGGCGCCGGCGGCTGCGG + Exonic
1072891518 10:99329387-99329409 GATGGCGGCGGCCGCGGCGGCGG + Exonic
1073058257 10:100715699-100715721 GACGGCGCCGGCGGCGGCTGGGG - Intergenic
1073207150 10:101775423-101775445 GAAGGGGGCAGCCGCGGCCAGGG - Intronic
1073266418 10:102230802-102230824 GCCCGGGGCAGCCGCGGCGGAGG + Exonic
1074786914 10:116849576-116849598 GAAGGCGGCGGCCGCAGCTGTGG + Exonic
1075443117 10:122494825-122494847 GACGGGGGTCACTGCGGGTGAGG + Intronic
1076496110 10:130898815-130898837 GACGGGTGCGGCTGAGGCTGTGG - Intergenic
1077074670 11:694951-694973 GGCGGCGGCGGCCGCGGCCGCGG - Exonic
1077539347 11:3139285-3139307 GACGGGTGGCCCCGGGGCTGGGG + Intronic
1081575435 11:44316273-44316295 GGCAGGGGCTGCGGCGGCTGGGG - Intergenic
1083033492 11:59615499-59615521 GACGGTGGTCGCGGCGGCGGCGG - Exonic
1083258120 11:61508891-61508913 CCCGGGGGCCGGCGCGGCTCCGG + Exonic
1083728821 11:64642536-64642558 TACCGTGGCCGCCGCGGGTGAGG + Intronic
1083904828 11:65662770-65662792 CGCCGGGGCCGCCGCGGCTGTGG - Intronic
1084021324 11:66420005-66420027 TCCGGCGGCTGCCGCGGCTGCGG - Intergenic
1084192037 11:67503800-67503822 GAGGGGGGCCTCCGCGGCAGAGG - Intronic
1084973026 11:72781680-72781702 GCCGGGGCCCGCCGGGGCCGGGG + Intronic
1085052675 11:73387855-73387877 GCTCAGGGCCGCCGCGGCTGAGG - Intronic
1085076679 11:73597944-73597966 AACGGCGGCGGCGGCGGCTGAGG + Exonic
1085333097 11:75668916-75668938 GGCGGTGGCGGCGGCGGCTGCGG - Exonic
1085597168 11:77820687-77820709 GACGGCGGCGGCAGCGGCGGCGG - Exonic
1087672750 11:101127541-101127563 CGCGGGGGCCGCCCCGGCGGCGG + Exonic
1089543713 11:119206448-119206470 GCCGGGGGCGGCAGCGGCTCCGG + Exonic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1091558576 12:1594152-1594174 GGCGGCGGCGGCGGCGGCTGGGG - Exonic
1091603916 12:1934697-1934719 GATGGGGGCCACCCCGGCTTTGG - Intergenic
1093958792 12:25250904-25250926 GGCGGCGGCCGCGGCGGCGGAGG - Intronic
1094041076 12:26122474-26122496 GAAGGGGGCCGCGGCGGCCGCGG + Exonic
1096192644 12:49630570-49630592 GAAGGGGGCAGGCGCTGCTGGGG - Exonic
1096598699 12:52714476-52714498 AGCCGGGGCCGCAGCGGCTGGGG - Intergenic
1096668142 12:53180741-53180763 GGTGGGGGCAGCCGCGGCGGTGG + Exonic
1097648139 12:62260608-62260630 GGCGGCGGCCGCCGGGGCAGCGG + Intronic
1097854872 12:64452004-64452026 GGCAGTTGCCGCCGCGGCTGTGG + Exonic
1098991161 12:77065809-77065831 GACGCGGGCCCCGGCGGCCGCGG + Intergenic
1100089703 12:90954675-90954697 GGCGGTGGCGGCGGCGGCTGTGG - Exonic
1100260710 12:92929518-92929540 GCTGGGGGACGCCGAGGCTGCGG + Intergenic
1100329754 12:93571887-93571909 GGCGGCGGCGGCCGCGGCCGAGG + Exonic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1101253829 12:102958348-102958370 GGCTGCGGCCGCCGCGGCTGCGG - Exonic
1101592723 12:106138629-106138651 GGAAGGGGCCGCCGCGCCTGTGG - Exonic
1101641321 12:106587277-106587299 GACGGGGGCGGGAGCGGCTTTGG - Intronic
1102339232 12:112108655-112108677 GCCGAGGGCTGCCGAGGCTGGGG - Intronic
1102370951 12:112382098-112382120 GTCGGCGGCCGCGGCGGCGGCGG - Intronic
1102589263 12:113945338-113945360 GACTGGGGCTGCCTGGGCTGCGG + Intronic
1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG + Exonic
1103807476 12:123584574-123584596 GGCGGCGGCGGCGGCGGCTGTGG + Exonic
1103956053 12:124577447-124577469 GACGGCGGCGGCCGGGGGTGAGG + Intergenic
1104444714 12:128823865-128823887 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1104879716 12:132062174-132062196 GTCAGGGGTCGCCGTGGCTGGGG - Exonic
1104891867 12:132144075-132144097 GACGGCGGCCCCGGCGGCGGCGG - Exonic
1105504665 13:20999233-20999255 GTCGGAGGCGGCCACGGCTGGGG - Intronic
1106029604 13:25988205-25988227 GACAGGGACCCCAGCGGCTGAGG - Intronic
1111396303 13:87672632-87672654 GCCTGGGGCCGCCGCCGCGGTGG - Exonic
1112656134 13:101453977-101453999 GGCCGGGGCCGCTGCGACTGCGG + Exonic
1113377932 13:109782236-109782258 GGCGGCGGCGGCTGCGGCTGGGG + Exonic
1113655926 13:112067761-112067783 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
1113914856 13:113864035-113864057 GGCGGCGGCGGCGGCGGCTGCGG + Exonic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1116886985 14:50231464-50231486 GGCGAGGGCCGCCTCGGCGGAGG - Exonic
1117156849 14:52950710-52950732 GGCGGCGGCGGCCGGGGCTGCGG + Intronic
1118289203 14:64504519-64504541 CGCGGGGGCCGTCGCGGCGGCGG - Intronic
1119004159 14:70908430-70908452 GACGAGGGCCGCGGCGGGGGCGG - Intronic
1119035605 14:71228095-71228117 GAGAGGGGCAGCCGGGGCTGAGG + Intergenic
1119472726 14:74909680-74909702 GATGGGGCCGGCCGGGGCTGTGG - Exonic
1119821037 14:77616451-77616473 GCCGGCGGCGGCTGCGGCTGCGG + Exonic
1121013627 14:90535486-90535508 GAGGGGGGCTGCCTTGGCTGGGG - Exonic
1121803865 14:96797504-96797526 GAGGCGGGCGGCCGGGGCTGGGG + Intronic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122275178 14:100587362-100587384 GCCGGGAGCCGGCGCGGCCGGGG + Intronic
1122516754 14:102314395-102314417 GACGGGGCGCGCCGGGGCCGGGG - Intergenic
1122558317 14:102593041-102593063 GGCGGCGGCGGCCGAGGCTGAGG - Exonic
1123047695 14:105526761-105526783 GGCGGGGGCCGATGCGGCAGGGG + Intronic
1123105826 14:105840674-105840696 GACGGGTGCCTGCGCAGCTGCGG + Intergenic
1124496786 15:30192062-30192084 GGCGGGGGCGGGGGCGGCTGGGG + Intergenic
1124746790 15:32346585-32346607 GGCGGGGGCGGGGGCGGCTGGGG - Intergenic
1125596948 15:40893491-40893513 GGCGGGGGCCGCCCAGCCTGAGG - Intergenic
1127225143 15:56919543-56919565 GCCGGGCCCGGCCGCGGCTGGGG - Intronic
1128651171 15:69414672-69414694 GGCGGGGGGCGACGCGGCAGGGG - Intronic
1129540856 15:76346294-76346316 GAAGGGAGCCGCCGCCGCTGCGG + Intergenic
1130261134 15:82355264-82355286 GGCGGCGGCAGCAGCGGCTGCGG - Intergenic
1130280101 15:82513754-82513776 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130471476 15:84229940-84229962 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130478970 15:84344511-84344533 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1130492800 15:84443620-84443642 GGCGGCGGCAGCAGCGGCTGCGG - Intergenic
1130531110 15:84748489-84748511 GGCTGGGGCTGCCGCGGCGGGGG - Intergenic
1130593770 15:85234567-85234589 GGCGGCGGCAGCAGCGGCTGCGG + Intergenic
1131215192 15:90530225-90530247 GGCGGGGGCGGCCACGGCCGCGG + Intronic
1131493532 15:92882948-92882970 GAGTGGGGCTGCCGCGGCTGAGG + Intergenic
1131937481 15:97522654-97522676 GACGGAAGCCCCCGGGGCTGGGG - Intergenic
1132527654 16:425714-425736 GACGGGGGCCGAGGAGGCCGGGG - Exonic
1132544696 16:527848-527870 GTCGGGGCGCCCCGCGGCTGAGG + Exonic
1132548323 16:543772-543794 GACGGAGGGCGCCGGGACTGGGG + Intronic
1132757570 16:1493512-1493534 GTCCGGGGCCGCGGCGGCCGTGG + Exonic
1132793373 16:1706186-1706208 GACGGGCGCAGCCTCGGCAGCGG + Exonic
1132872446 16:2121919-2121941 GATGGAGGCCGCCCCGGCTTGGG - Intronic
1132885097 16:2179027-2179049 GGCGGGGGGCGCGGCGGCGGCGG + Exonic
1132959121 16:2612429-2612451 TAGGGGGGCCGCCGAGGCTCCGG + Intergenic
1132972181 16:2694404-2694426 TAGGGGGGCCGCCGAGGCTCCGG + Intronic
1136910330 16:34140394-34140416 GCCGCAGGCCGACGCGGCTGTGG + Intergenic
1137708028 16:50548668-50548690 GGCGGCGGCAGCCGCGGCGGCGG - Intronic
1138105597 16:54285844-54285866 GGCGGCGGCCGCAGCGGCCGCGG + Exonic
1139475345 16:67200061-67200083 GGCGGGGGCCTCCGGGGCGGGGG - Intronic
1139664890 16:68448443-68448465 GGCGGCGGCCGCAGCGGCGGCGG + Exonic
1139917808 16:70439028-70439050 GACGGCGGCGGCGGCGGCGGCGG - Intronic
1140091941 16:71846032-71846054 GATGGCGGCGGCCGCGGTTGCGG + Exonic
1140355207 16:74299399-74299421 GACAGGGTCTGCCGAGGCTGGGG + Intronic
1141132267 16:81444677-81444699 GGCGGCGGCCGCGGCGGCTTCGG - Intergenic
1141531365 16:84648801-84648823 GAGTGGGGGCGCCGCGGCCGGGG + Intronic
1141840106 16:86568524-86568546 GGCGGGGGCGGCGGCGCCTGCGG - Exonic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1142683417 17:1562921-1562943 GAGGTGGGGCCCCGCGGCTGGGG + Intergenic
1142974804 17:3636920-3636942 AAAGGAGCCCGCCGCGGCTGAGG - Intronic
1143477648 17:7211782-7211804 GGCGGGGGCTGCGGCGGCCGCGG + Intronic
1143503904 17:7353460-7353482 GACTGGGGCTGCAGCCGCTGTGG + Exonic
1143590781 17:7885056-7885078 GGCGGGGGCGGCGGCGGCGGGGG - Exonic
1143632740 17:8148137-8148159 GACGAGGGCAGCCAGGGCTGAGG - Intronic
1144339724 17:14301576-14301598 GGCGGGGGCGGCGGCGGCTGCGG - Exonic
1144682748 17:17206244-17206266 GGTGGCGGCCGCGGCGGCTGTGG - Exonic
1145846282 17:28041830-28041852 GAAGGCGGCCGCGGCGGCTGAGG + Intronic
1145915496 17:28571475-28571497 CATGGCGGCCGCCGGGGCTGCGG - Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1146371135 17:32266154-32266176 TCCGGGGGCGGCGGCGGCTGCGG - Exonic
1146398560 17:32487009-32487031 GACGGCGGCGGCGGCGGCGGCGG - Exonic
1147006303 17:37406802-37406824 GGCGGGGGCCTCCACGGCCGAGG + Intronic
1147139531 17:38453623-38453645 GACAGGGGCCGCCCCGGAGGGGG + Intronic
1147161772 17:38572778-38572800 GGCGGCGGCGGCCGCGGCTGCGG - Intronic
1147719824 17:42532200-42532222 GGCGGCGGCGGCGGCGGCTGCGG - Intergenic
1147971151 17:44219620-44219642 GGCGGCGGCGGCGGCGGCTGTGG + Intronic
1148848394 17:50542077-50542099 GGCGTGGGCAGCAGCGGCTGCGG - Exonic
1149994705 17:61400353-61400375 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150768284 17:68020078-68020100 GGCGCGCGCCGCCGCCGCTGGGG - Intergenic
1150791966 17:68205968-68205990 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1151417659 17:73977097-73977119 GGAGGTGGCCGCCGTGGCTGTGG - Intergenic
1151612043 17:75182684-75182706 CACGGGGCCGGCCGCGGCTCAGG - Intergenic
1152545867 17:80999879-80999901 CATGGGGGTCCCCGCGGCTGGGG + Exonic
1152714310 17:81891267-81891289 GAGGGGGCCAGCCGGGGCTGGGG - Intronic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1153514490 18:5891374-5891396 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1153805384 18:8705591-8705613 GACGGCGGCGGCGGCGGCGGCGG - Intergenic
1154303910 18:13217504-13217526 TACCGGGGCCGCCGTGGCGGGGG - Intronic
1155213106 18:23619644-23619666 GGCGGCGGCCGCCGTGACTGGGG + Intronic
1155392495 18:25351151-25351173 GACGGCGGCGGCGGCGGCGGCGG + Intronic
1157383934 18:47247073-47247095 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1157849135 18:51030710-51030732 GACGGCGGCGGCGGCGGCGGCGG + Intronic
1157867054 18:51196771-51196793 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1157867208 18:51197250-51197272 GGCGGGGGCGGCTGCGGCAGGGG + Exonic
1158137592 18:54224219-54224241 GACGGCGGCGGCTGCGGCGGCGG - Exonic
1158404293 18:57147319-57147341 GACGGTGGCGGCGGCGGCAGCGG + Exonic
1160425025 18:78773583-78773605 GACAGGGGCCCACGAGGCTGTGG - Intergenic
1160738808 19:676601-676623 GTCGGGGGGCGCGGCGGCGGCGG + Intronic
1160760563 19:782125-782147 GATGGGGGCTGCAGGGGCTGGGG + Intergenic
1160910210 19:1470611-1470633 GACGGCGCCCGCCGCAGGTGGGG + Exonic
1160930589 19:1568000-1568022 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1160967696 19:1753825-1753847 GACGGCGGCGGCGGCGGCGGCGG + Exonic
1161112155 19:2476535-2476557 GACGGTGACCGCCGCGGTGGAGG + Exonic
1161208984 19:3056566-3056588 GCAGGGGGCCGCTGGGGCTGCGG + Intronic
1161327161 19:3669448-3669470 GACGGGGGCCGTCAGGGGTGGGG + Intronic
1161703097 19:5805375-5805397 GATGGCGGTCGCGGCGGCTGGGG + Intergenic
1162018195 19:7856842-7856864 GTCGGGGGTGCCCGCGGCTGTGG - Intronic
1162142954 19:8595704-8595726 GGAGGGGGCCGCTGGGGCTGGGG - Intronic
1162344231 19:10110407-10110429 GGCCGGGGCCGCCGGGGGTGGGG + Intronic
1162435282 19:10654442-10654464 GAGGGCGGCGGCGGCGGCTGCGG + Exonic
1162751757 19:12833845-12833867 GGCGGCGGCGGCGGCGGCTGAGG - Intronic
1162935361 19:13979110-13979132 AACGGGGGCGGCCGCGGGCGGGG + Intronic
1163148641 19:15398687-15398709 GCCGGGCGCCGGCGAGGCTGAGG + Intronic
1163583727 19:18153259-18153281 GACGGCGGCTGCGGCGGCGGTGG + Exonic
1163627307 19:18397537-18397559 CACGGGGGCCGCAGCGGCCACGG + Exonic
1165199784 19:34134458-34134480 GAGGGGCGTGGCCGCGGCTGGGG + Intergenic
1165420077 19:35718106-35718128 GGCGGGGGCCGCGGCGGACGGGG + Exonic
1165476258 19:36032626-36032648 GGAGGGGGCAGCCGCGACTGAGG - Intronic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1165772030 19:38385699-38385721 GATGGGCGCAGCCGCGGGTGCGG + Exonic
1165774022 19:38394695-38394717 GATGGGGGCCGCAGCGGCGCTGG - Exonic
1165906411 19:39197131-39197153 CTCGGGGGCCTCCGGGGCTGCGG - Exonic
1165928609 19:39342441-39342463 GACGGCGGCGGCGGCGGCGGCGG + Intronic
1166857956 19:45792569-45792591 GGCGGGGGCTGCGGTGGCTGAGG + Exonic
1166888062 19:45973467-45973489 GGCGGGGGCGGCGGCGGCTGCGG + Exonic
1167258105 19:48443024-48443046 GGCGGTGGCCGCGGCGGCGGGGG - Exonic
1167258108 19:48443027-48443049 GACGGCGGTGGCCGCGGCGGCGG - Exonic
1167268310 19:48494028-48494050 CACGGGGGCCGCCGCGGGCCCGG + Exonic
1168072975 19:53963016-53963038 GCCCGGGGCCGGCGGGGCTGGGG - Intergenic
1168246996 19:55117457-55117479 GACGGGAGCAGCTGCGGCAGTGG - Exonic
1168339514 19:55615133-55615155 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1168339515 19:55615136-55615158 GGCGGCGGCCGCGGCGGCGGTGG + Exonic
925169688 2:1743513-1743535 GAGCGGGGGCGCCGCGGCTGCGG + Intronic
926035185 2:9630743-9630765 GGCGGGAGCGGCCGCGGCTCGGG - Intronic
927472269 2:23385399-23385421 CCCCGCGGCCGCCGCGGCTGCGG + Exonic
928928014 2:36598016-36598038 GGCGGGGGCCGAGGCGGGTGGGG - Exonic
930189211 2:48440818-48440840 GGCGGCGGCGGCGGCGGCTGCGG + Exonic
931763601 2:65436193-65436215 GAGCGGGGGCGCCGCGGCAGCGG - Intergenic
932087471 2:68774944-68774966 GACGGGGCCCGCCGCGGTGCCGG + Intronic
932567684 2:72919976-72919998 CCCGCGGGCCGCCGCGGCCGAGG + Intronic
932621869 2:73269454-73269476 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
932621870 2:73269457-73269479 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
933684713 2:85133700-85133722 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
934098209 2:88627073-88627095 GGCGGCGGGCGCCGTGGCTGCGG - Exonic
934882430 2:97995671-97995693 GCCGGGGGCCGCCGCGCTCGAGG + Exonic
935265158 2:101387419-101387441 GCCGGCGGCCGGCGCGGCCGGGG - Exonic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
935592498 2:104855411-104855433 GGCGGGGGGCGCGGCGGCGGCGG + Intergenic
935592638 2:104855919-104855941 GGCGGTGGCGGCGGCGGCTGCGG - Exonic
935592695 2:104856088-104856110 GGCGGCGGCGGCTGCGGCTGCGG - Exonic
935592696 2:104856094-104856116 GGCGGCGGCGGCGGCGGCTGCGG - Exonic
936122683 2:109760395-109760417 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936222010 2:110611078-110611100 GGCGGGGGCGGCGGCGGCGGCGG - Intergenic
937044987 2:118846540-118846562 GGCGGCGGCCGCGGCGGCAGTGG - Exonic
937160935 2:119760179-119760201 GCCGCGGGCCGGCGCCGCTGGGG - Exonic
937221285 2:120344496-120344518 GCCGGGGGCGGCCACGGCGGCGG + Intergenic
937932621 2:127218861-127218883 GGAGGGCGCCGCCGCGGCTCGGG + Intronic
938406244 2:131034875-131034897 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
940038036 2:149330487-149330509 GGCCGGGCCGGCCGCGGCTGCGG + Intronic
942448395 2:176093064-176093086 GGCGGCGGCAGCGGCGGCTGCGG + Exonic
942450935 2:176107679-176107701 GGCGGCGGCGGCGGCGGCTGCGG + Exonic
943692346 2:190881374-190881396 GCCGGGCGCCGCCGGGGCAGCGG - Exonic
946416763 2:219543773-219543795 GACAGCTGCGGCCGCGGCTGAGG - Exonic
946692400 2:222319467-222319489 GGCGGCGGCGGCGGCGGCTGCGG + Intergenic
946921434 2:224585171-224585193 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947549784 2:231037838-231037860 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
1168795953 20:610311-610333 GGCGGGGGCCGGCGGGGCCGTGG - Exonic
1168883251 20:1225635-1225657 GGCGGCGGCGGCGGCGGCTGGGG - Intergenic
1169345169 20:4823369-4823391 AAGTGGGGGCGCCGCGGCTGGGG + Intronic
1171175528 20:23048938-23048960 GACGGCGGCAGCCGCGGCGCCGG + Exonic
1171473494 20:25390379-25390401 GACGGGGGCGGCCGCGGATCGGG + Intronic
1171905800 20:30899125-30899147 GCCGCAGGCCGACGCGGCTGTGG + Intergenic
1173704172 20:45098003-45098025 GGCGGCGGCCGCCGTGGCTGCGG - Exonic
1174874026 20:54208326-54208348 GAGGCGGGGCGCCGGGGCTGGGG + Intronic
1175429104 20:58890254-58890276 GGCGGCGGCCGCGGCGGCGGCGG - Intronic
1175429105 20:58890257-58890279 GTCGGCGGCGGCCGCGGCGGCGG - Intronic
1176548599 21:8212238-8212260 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176556493 21:8256446-8256468 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176567530 21:8395273-8395295 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176575432 21:8439488-8439510 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1178334671 21:31732285-31732307 GGCGGCGGCGGCCGCGGCCGCGG + Intergenic
1179605619 21:42513744-42513766 GCCGGGGGTCGCGGCGGCCGGGG + Intronic
1180055725 21:45358267-45358289 GATGGGGGCCGCGGCTGCTCCGG - Intergenic
1180339215 22:11605226-11605248 GCCGCAGGCCGACGCGGCTGTGG + Intergenic
1180559231 22:16601991-16602013 GGCGGCGGCGGCCGCGGCGGCGG + Intergenic
1180733810 22:18001198-18001220 GCCGGGAGCCGCCGCGGCGCGGG - Intronic
1181934618 22:26429606-26429628 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
1182369710 22:29802184-29802206 CATGGGAGCAGCCGCGGCTGTGG - Exonic
1182904127 22:33921320-33921342 GCCGGGAGCCGCCGGGGTTGGGG - Intronic
1183578225 22:38706041-38706063 GGCGGCGGCCGCCGCGGCCCTGG - Exonic
1183931420 22:41238043-41238065 GCCAGGGGCCGCGGCGCCTGCGG - Exonic
1185038180 22:48490280-48490302 GAGGGGGCTCGCCGCGGCCGCGG + Intronic
1185255125 22:49827539-49827561 CGCGGGGGCCGGCGCGGCCGAGG + Intergenic
1203261537 22_KI270733v1_random:173621-173643 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
952744449 3:36764220-36764242 GCCGGGGGCGGCGGCGGCTGCGG + Intergenic
953705060 3:45225173-45225195 GGCGGCGGCGGCGGCGGCTGCGG + Exonic
954632795 3:52056297-52056319 TTCGGGGGCGGCGGCGGCTGGGG - Exonic
955239339 3:57165355-57165377 GGCGGTGGCCGCGGCGGCCGCGG + Exonic
955856505 3:63278592-63278614 GGCGGGGGATGCCGCGGCTTGGG + Intronic
956675046 3:71725335-71725357 GGCGGGGGGCGCGGCGGCCGGGG + Exonic
960386412 3:117026601-117026623 GCCGGAGTCCGCGGCGGCTGAGG - Intronic
961858240 3:129893632-129893654 GACTGAGGCGGCGGCGGCTGAGG - Intergenic
962301817 3:134250398-134250420 GAGTGGGGCCGCCGAGGCCGGGG - Intronic
965390171 3:168095300-168095322 GGCGGGGGCGGCCGCGGCTTTGG - Exonic
965615121 3:170585596-170585618 GGCGGGGGCCAGCGCGGCTCCGG - Intronic
966711824 3:182980176-182980198 GCCGGGGCCCGGCGCGGGTGGGG - Intronic
966883218 3:184361458-184361480 GATGGCGGCCGCGGCGGCGGAGG - Exonic
967118397 3:186361919-186361941 GACGGCGGCCGGCGCGGCGGAGG - Intronic
967980323 3:195061524-195061546 GACGGGGGGAGCCCCAGCTGGGG + Intergenic
968323460 3:197791583-197791605 GCCGGGAGCCGCCCCGGCCGGGG + Intronic
968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372739 4:10939-10961 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968556738 4:1249493-1249515 GAGCGGGGCGGCTGCGGCTGCGG - Intronic
968674709 4:1871335-1871357 GGCGGCGGCGGCCCCGGCTGCGG + Intergenic
968820200 4:2844111-2844133 GGCGGGGGCCGCGGGGCCTGCGG + Intronic
968850575 4:3075012-3075034 GGCGGGGGCGGCTGCGGCTGAGG - Exonic
969413371 4:7043525-7043547 GGCCGGGGGCGCGGCGGCTGCGG + Exonic
970394818 4:15655308-15655330 GGCGGCGGCCGCGGCTGCTGAGG - Exonic
971288443 4:25312678-25312700 GGCGGGGGCTGCCGCGGCGGAGG - Intergenic
972265341 4:37454009-37454031 GACGGCGGCGGCGGCGGCGGCGG - Intronic
972585353 4:40432684-40432706 GACAGCGGCTGCGGCGGCTGCGG + Exonic
972585355 4:40432696-40432718 GGCGGCTGCGGCCGCGGCTGCGG + Exonic
975985958 4:80202066-80202088 CACGGGGGCGGCGGCGGCGGTGG + Exonic
980130070 4:128809981-128810003 GACGGCGGCGGCGGCGGCGGCGG + Intronic
980920911 4:139084445-139084467 GGCGGCGGCGGCGGCGGCTGTGG + Intronic
984888577 4:184473024-184473046 GCCGGCGTCCGCCGGGGCTGGGG - Intronic
984972489 4:185203715-185203737 GACAGGGGCGCCCGCGGCGGCGG - Intronic
985462652 4:190121598-190121620 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462662 4:190121656-190121678 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462667 4:190121685-190121707 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462672 4:190121714-190121736 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462677 4:190121743-190121765 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985504616 5:271853-271875 GGTCGGGGCCGCCGCGGCGGAGG - Intronic
985532685 5:443224-443246 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
985536977 5:471007-471029 GACGGAGCGCGCCGGGGCTGTGG - Exonic
985845109 5:2338761-2338783 GACGGGGCCAGCCCAGGCTGCGG - Intergenic
985896137 5:2751059-2751081 GGCGGGGGCCGCCGGGAATGTGG - Intronic
986297085 5:6448734-6448756 GGCGGCGGCGGCGGCGGCTGCGG + Exonic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
986330663 5:6714068-6714090 GGCGTGGGCCGCGGCGGCTCGGG + Intergenic
987132379 5:14871716-14871738 GACGGCGGCGGCGGCGGCGGCGG + Exonic
988577836 5:32444239-32444261 GGCGGCGGCGGCGGCGGCTGCGG - Exonic
990454134 5:55968074-55968096 GGCATGGGCCGCCGCGCCTGGGG + Intronic
990955032 5:61332342-61332364 GGCGGGGGCAGCAGCGGCGGCGG + Exonic
993900168 5:93579613-93579635 GGCGGGGGCAGCCGATGCTGGGG - Intergenic
995106240 5:108381021-108381043 GGCGGGGGCTGCGGCGGCGGCGG - Exonic
995145978 5:108787318-108787340 GAGGGGGGCCGCAGGGGCTGAGG + Intronic
995571707 5:113488390-113488412 GATGGCGGCCGCGGCGGCAGCGG - Exonic
996978489 5:129461458-129461480 GACGGGGGCGGCTGCGGGGGAGG - Exonic
997013425 5:129904715-129904737 GCCGGCTGCGGCCGCGGCTGGGG + Exonic
998138471 5:139687020-139687042 GAGAGGGGCCGCAGCGGCCGTGG - Intergenic
998200481 5:140114290-140114312 GGCGGGGGCGGCGGCGGCAGTGG + Exonic
1000302884 5:159972030-159972052 GTCGGCGGCGGCCGCGGCCGCGG - Exonic
1001065070 5:168529574-168529596 GGCGGGGGCCGAGGCGGCGGCGG + Exonic
1001065111 5:168529676-168529698 GGCGGGGGCGGCCGGGGCCGGGG + Exonic
1002784482 6:391561-391583 GCTGGGGGCTGCCGCGGCCGGGG - Intergenic
1003049414 6:2766048-2766070 GCCGGCGGCCGCCGCCGCGGCGG + Exonic
1003139377 6:3457447-3457469 GTGGGGGGCCCGCGCGGCTGCGG - Intergenic
1003624090 6:7727050-7727072 GGCGGCGGCGGCCGCGGCAGCGG - Exonic
1004044699 6:12012483-12012505 GATGGCGGCGGCCGCGGCTCGGG - Exonic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1004251571 6:14026966-14026988 GAGGGGGGCAGCCGCAGCTGTGG + Intergenic
1004561869 6:16760229-16760251 GGCGGCGGCCGCCGCGGAGGAGG - Intronic
1007927658 6:45663283-45663305 GCCTGGGGGCGCCGAGGCTGCGG - Intronic
1008932437 6:56954857-56954879 GACGGGGGCGGGGGCGCCTGGGG - Intergenic
1013207511 6:107958169-107958191 GACGGCGGCGGCAGCGGCAGAGG - Exonic
1013299185 6:108787032-108787054 GATGGCGGCCACCGGGGCTGTGG - Intergenic
1013441787 6:110179204-110179226 GACGGCGGCGGGCGCGCCTGGGG - Intronic
1016817167 6:148313697-148313719 GACAGGGGCCTCGGTGGCTGTGG + Intronic
1016923325 6:149317407-149317429 GGCGGCGGCGGCTGCGGCTGCGG - Intronic
1016923326 6:149317413-149317435 GGCGGCGGCGGCGGCGGCTGCGG - Intronic
1017672246 6:156778741-156778763 GCCGGGGGCCCCGGCGGCGGCGG - Exonic
1017672310 6:156778946-156778968 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1017672311 6:156778949-156778971 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1017764088 6:157592922-157592944 GACGGGTCCCGCCGAGGCAGAGG + Intronic
1018400541 6:163415369-163415391 GAAAGGGGCCGCCCCGGCGGGGG - Intronic
1019714402 7:2531727-2531749 GACAGAGGCCGGGGCGGCTGCGG - Intergenic
1019741919 7:2679321-2679343 GACAGAGGCCGGGGCGGCTGCGG + Intergenic
1019828226 7:3301272-3301294 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1019989584 7:4682388-4682410 GAAGGCGGCGGCGGCGGCTGCGG - Exonic
1020007159 7:4789105-4789127 GACGGGGCCTGCCGGGGCTGTGG - Intronic
1020274294 7:6615499-6615521 GACGGCGGCGGCGGCGGCGGGGG + Intergenic
1021451283 7:20785427-20785449 GGCGGCGGCGGCGGCGGCTGCGG + Exonic
1022106256 7:27199840-27199862 GGCGGCGGCGGCCGCGGCTGCGG - Exonic
1022107180 7:27204988-27205010 GCCGGCGGCAGCCGCGGCAGCGG + Intergenic
1022528352 7:31052438-31052460 GACGGCGGCGGCGGCGGCTCCGG + Intergenic
1022650181 7:32267121-32267143 GCCAGGGGCCGCCGCTGCTCAGG - Intronic
1023067278 7:36390176-36390198 GGCCGGGGTCGCCGCGGCTGCGG + Intronic
1023529348 7:41136718-41136740 GAGGGGGGCCGAGGCGGCGGGGG + Intergenic
1023638416 7:42236479-42236501 CGCGGGGGCCGCCGCCGCTGGGG - Intronic
1023638421 7:42236486-42236508 GGCGGCGGCCCCCGCGGCGGAGG + Intronic
1023937293 7:44748948-44748970 GCCGGGGGCCGCCACGGCGAGGG + Exonic
1025207894 7:57004007-57004029 GACGGGGGCTGCGGCGCCGGGGG + Intergenic
1026909492 7:74083955-74083977 GGCGGGGCCCGGCGGGGCTGGGG - Exonic
1027228595 7:76260035-76260057 GTCAGCGGCCGCCGCGGCGGGGG + Intronic
1027251274 7:76400333-76400355 GAGTGCGGCAGCCGCGGCTGGGG - Exonic
1029123191 7:98281722-98281744 GGCGGGGGACGCGGCGGCGGCGG - Exonic
1029711123 7:102300576-102300598 GACTGGGACCGGGGCGGCTGCGG - Exonic
1029996757 7:105014162-105014184 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1029996758 7:105014165-105014187 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1030138734 7:106284667-106284689 GGCGCGGGCGGCGGCGGCTGGGG - Intronic
1030138765 7:106284739-106284761 GGCGGGGGCGGCTGGGGCTGGGG - Intronic
1031134834 7:117873337-117873359 GGCGGGGGCCGCGGCGGAGGCGG - Exonic
1032002158 7:128272310-128272332 TTCGGGGGCCGCCGAGGCTGGGG - Intergenic
1032087351 7:128891080-128891102 GGCGGGGGCTGGGGCGGCTGCGG + Exonic
1032193969 7:129779504-129779526 GGCGGGGGCGGGAGCGGCTGCGG - Intergenic
1032194425 7:129780947-129780969 GGCGGGGCCAGCCGGGGCTGGGG + Intergenic
1032306229 7:130734181-130734203 GGCGGCGGCAGCGGCGGCTGCGG - Intergenic
1034618016 7:152435838-152435860 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1034618237 7:152436543-152436565 GGCGGGGGCCGTCGAGGCGGCGG - Intergenic
1034708692 7:153171173-153171195 GTCAGGGGCCGCAGCGGCAGTGG + Intergenic
1035431971 7:158829367-158829389 GGCGGGCGCCGGCGGGGCTGGGG - Exonic
1036789544 8:11708833-11708855 GGCGGAGGCGGCGGCGGCTGCGG - Exonic
1037819034 8:22126979-22127001 GGAGGGGGCAGCCGGGGCTGGGG - Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1037879377 8:22565630-22565652 GGCGGGGGTCCCCGAGGCTGGGG - Intronic
1037887907 8:22604772-22604794 GGCGGCGGCAGCAGCGGCTGTGG + Exonic
1038311437 8:26449144-26449166 TGCGGGGGCCGCTGCGGGTGCGG - Intronic
1038319461 8:26514041-26514063 GAGGGCGTCCGCTGCGGCTGCGG - Exonic
1038828420 8:31032736-31032758 GGCGGCGGCGGCCGCGGCCGCGG - Exonic
1039542531 8:38383064-38383086 GTCGCGGTCCCCCGCGGCTGGGG - Intergenic
1041201640 8:55455246-55455268 CGCGGCGGCCGCAGCGGCTGCGG + Intronic
1041690396 8:60680409-60680431 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1043463947 8:80486934-80486956 GGCGGGGGCTGTCTCGGCTGGGG - Exonic
1047079929 8:121448357-121448379 GAAGGGGGCCCCAGCAGCTGTGG - Intergenic
1048214126 8:132480462-132480484 GACGGGGGCGGCGGAGGCGGCGG - Exonic
1049109849 8:140635780-140635802 GGCGGGGTCCGCGGCGGCGGCGG + Intergenic
1049532304 8:143160523-143160545 GTAGGGGGCCGCGGAGGCTGGGG - Intronic
1049762267 8:144336888-144336910 GACGGCGGCGGCGGCGGCGGCGG + Intergenic
1049788588 8:144462811-144462833 GTCGGTGGCCGCGGCGGCTGTGG - Intronic
1051079688 9:13279654-13279676 GACCGGGGCTGCCGCGGAGGCGG + Intergenic
1053072881 9:35111476-35111498 GAGGGGCGCGGCAGCGGCTGGGG - Exonic
1053697401 9:40650740-40650762 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054308706 9:63450186-63450208 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054407370 9:64773879-64773901 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054489437 9:65762641-65762663 GGCGGGGGCCGCGGCGGTGGGGG - Intergenic
1054731319 9:68705208-68705230 CGCGGCGGCTGCCGCGGCTGGGG - Intergenic
1054798677 9:69325551-69325573 GCCCGGGGCCGCGGCGGCAGCGG - Intronic
1055514157 9:77020141-77020163 GGCGGCGGCGGCGGCGGCTGGGG - Exonic
1055514160 9:77020147-77020169 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1055936834 9:81611793-81611815 CACGGCGGCCGCGGCGGCTGCGG + Exonic
1057596231 9:96418046-96418068 GCCCGGGGCCGCCGGAGCTGGGG - Exonic
1057758419 9:97854414-97854436 GGCGGCGGCGGCGGCGGCTGCGG - Exonic
1057881528 9:98796302-98796324 GCCCGGGGCCGCAGCGGCGGGGG - Exonic
1059102657 9:111484484-111484506 GTCGGGGGCCGCTGCGGCGCAGG - Exonic
1060087302 9:120714263-120714285 GACGGCGGCGGCGGCGGCGGCGG + Exonic
1060529478 9:124339940-124339962 GACGGGGGCAGGGGCAGCTGGGG - Intronic
1060979890 9:127785891-127785913 GGCGGGGGCAGCGGCGGCGGCGG + Intronic
1061365989 9:130172641-130172663 GGCGGGGGCCGCGGCCGCCGAGG + Exonic
1061387025 9:130296405-130296427 GACAGGGCCTGCCGGGGCTGAGG + Intronic
1061700277 9:132410359-132410381 GTCAGGGGCCGCCGCGGGGGCGG - Exonic
1061726092 9:132582727-132582749 GGCAGGGGCAGCGGCGGCTGGGG + Exonic
1061858399 9:133455552-133455574 GGCAGGAGCCGCCGAGGCTGGGG - Exonic
1062064367 9:134518241-134518263 GAAGGGGGCCGTGGCTGCTGCGG + Intergenic
1062332244 9:136049897-136049919 GGCGGTGGCCGCGGGGGCTGCGG - Exonic
1062332298 9:136050045-136050067 GTAGGGGGCCGCGGCGGCGGCGG + Exonic
1062398808 9:136363531-136363553 GCCGGGGCCCGCGGCGGCTCTGG - Exonic
1062491681 9:136808001-136808023 GAGCGGAGCAGCCGCGGCTGAGG + Exonic
1202779769 9_KI270717v1_random:24098-24120 GGCGGGGGCCACGGCGGCGGGGG + Intergenic
1203469883 Un_GL000220v1:111690-111712 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203477704 Un_GL000220v1:155662-155684 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1187900906 X:24025749-24025771 GACGCGGGGCGCCGCGGGCGCGG - Intronic
1187915547 X:24149801-24149823 CCCGGGTGCCGCCGCGGCCGCGG + Intronic
1189407088 X:40735280-40735302 GGCGGCGGCCGCTGCAGCTGCGG - Exonic
1192657051 X:73003237-73003259 GGCGGTGGCGGCAGCGGCTGCGG + Intergenic
1192665069 X:73079764-73079786 GGCGGTGGCGGCAGCGGCTGCGG - Intergenic
1192925005 X:75747094-75747116 GGCGGCGGCCGCGGCGGCGGCGG - Intergenic
1195138178 X:101931791-101931813 GACGGCGGCGGCGGCGGCTTTGG - Intronic
1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG + Exonic
1197199052 X:123733004-123733026 GAAGATGGCGGCCGCGGCTGTGG - Exonic
1197766153 X:130060569-130060591 GGCGGAGGCGGCCGCGGCCGCGG - Intergenic
1197774464 X:130110527-130110549 GACGGCGGCCCCGGCGGCCGCGG - Intronic
1198388092 X:136147536-136147558 GGCGGTGGCGGCGGCGGCTGCGG - Exonic
1198807157 X:140504020-140504042 GGCGGCGGCCGCGGCTGCTGTGG + Exonic
1199500381 X:148500715-148500737 GGCGGGGGCGGCCGGGGCAGAGG - Exonic
1200002596 X:153069704-153069726 GGCGGGGGCGGCCGAGGCGGGGG + Intergenic
1200005128 X:153080306-153080328 GGCGGGGGCGGCCGAGGCGGGGG - Intergenic