ID: 1196735154

View in Genome Browser
Species Human (GRCh38)
Location X:118976140-118976162
Sequence CCGCCGGGTGTTGCCCCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196735147_1196735154 6 Left 1196735147 X:118976111-118976133 CCGGTCGGCGCCTGCGTCCGCCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1196735154 X:118976140-118976162 CCGCCGGGTGTTGCCCCTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
1196735148_1196735154 -4 Left 1196735148 X:118976121-118976143 CCTGCGTCCGCCGCTCGCGCCGC 0: 1
1: 0
2: 2
3: 32
4: 304
Right 1196735154 X:118976140-118976162 CCGCCGGGTGTTGCCCCTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
1196735146_1196735154 20 Left 1196735146 X:118976097-118976119 CCAGCAGGAGATGTCCGGTCGGC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1196735154 X:118976140-118976162 CCGCCGGGTGTTGCCCCTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196735154 Original CRISPR CCGCCGGGTGTTGCCCCTTC CGG Intronic
902388429 1:16089003-16089025 CCCCTGGGTCTTGCCCCTGCAGG - Intergenic
902447075 1:16474294-16474316 CCGCCGGCTGCTGCACCTTCTGG + Intergenic
905183009 1:36178167-36178189 CCGCGGGGGGCTGCTCCTTCTGG - Exonic
908582032 1:65525968-65525990 CCGCCGGGCGCTGGCCCCTCTGG - Intronic
910284457 1:85538464-85538486 CCCCCGGGTGTTCCCCTTTTAGG - Intronic
917580166 1:176368940-176368962 CTGCCAGGTGCTGCCTCTTCTGG - Intergenic
1063367857 10:5502206-5502228 CCGCTGCGTGTTTCCCCATCCGG + Intergenic
1082936145 11:58658846-58658868 CCACCCTGTGTTGCCCCTTGTGG + Intronic
1084013293 11:66364391-66364413 CAGCCGGCTGCTGCCCCTGCTGG - Exonic
1103518156 12:121520787-121520809 CCTCCGGGTGTGGCTCCTACAGG + Intronic
1115028186 14:28766611-28766633 CCGCCGGCTGCCGCCCCCTCGGG - Intergenic
1135774687 16:25246618-25246640 CCCCCGGGTTTGGCCACTTCTGG + Intronic
1136544963 16:30949526-30949548 CCACCGGGTGTGACCCCTCCCGG - Intronic
1145251205 17:21297925-21297947 CCACCGCCTGTTGCCCTTTCTGG + Intronic
1148323790 17:46771938-46771960 CCGCCGCGCCTCGCCCCTTCCGG + Intronic
1152153257 17:78616135-78616157 TCGTCCGGTTTTGCCCCTTCCGG - Intergenic
1152252549 17:79219533-79219555 TCGCCTGGTACTGCCCCTTCAGG + Intronic
1152255033 17:79234054-79234076 CCGCCGGGTGTTGGCCTCACAGG - Intronic
1152754488 17:82081556-82081578 GCGCCAGGTGTTTCCCCTGCTGG - Intronic
1152856043 17:82664878-82664900 CCGCTGGGTGTGCCCCCGTCTGG + Intronic
1156295283 18:35783948-35783970 CTGCCGGGTGCTGATCCTTCCGG - Intergenic
1157701186 18:49762361-49762383 CCGCCGGCAGTGGTCCCTTCCGG - Intergenic
928880710 2:36093127-36093149 CCCCAGGGGGTTGCCACTTCTGG - Intergenic
932495782 2:72145089-72145111 GCGCCGGGTGCTGCCCCGGCAGG - Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
942458371 2:176152644-176152666 CTGCCGGGTGTAGGCCGTTCGGG - Exonic
1172012616 20:31854725-31854747 CAGCCTGGTGTTGCCCTTGCTGG + Intronic
961997346 3:131259793-131259815 CCTCCAGCTGTGGCCCCTTCAGG - Intronic
987128527 5:14838542-14838564 CAGCAGGGTTTTGCCGCTTCAGG - Intronic
992268950 5:75046424-75046446 CCGCTAGGTGTTGTTCCTTCTGG + Intergenic
996580702 5:125029259-125029281 GCTCCGGGTTTTGCCCCTGCTGG + Intergenic
1002001624 5:176199480-176199502 CCGCCTTGCGCTGCCCCTTCCGG - Intergenic
1002252713 5:177939500-177939522 CCGCCTTGCGCTGCCCCTTCCGG + Intergenic
1005892668 6:30153095-30153117 CCTCCTGGTGTTGCCACTTCTGG - Exonic
1009861455 6:69339351-69339373 CTGTGTGGTGTTGCCCCTTCTGG + Exonic
1018853985 6:167662668-167662690 CCGCCAGGTGTGGCTCCTCCTGG - Intergenic
1027172049 7:75879331-75879353 CCTCCGGGACTCGCCCCTTCAGG + Intronic
1047102761 8:121696200-121696222 CCTGCTGGTGTTTCCCCTTCTGG - Intergenic
1047811055 8:128409490-128409512 CCTCCAGGTGTTGCCCCCTTGGG - Intergenic
1049511192 8:143027352-143027374 CCCCCTGGCGCTGCCCCTTCAGG - Intergenic
1053131264 9:35617080-35617102 CCGCGGGGTGCAGCTCCTTCCGG - Intronic
1058101039 9:100917833-100917855 CCGCCTGCAGTTGCCCTTTCAGG + Intergenic
1062253238 9:135608692-135608714 CAGCCTGGTGTGGCCCCTTTTGG - Intergenic
1193130074 X:77910595-77910617 CTTCCGGGTGATGCCCCTGCCGG - Intergenic
1195847612 X:109245099-109245121 CTTCCGGGTTTTGCCCATTCAGG + Intergenic
1196735154 X:118976140-118976162 CCGCCGGGTGTTGCCCCTTCCGG + Intronic