ID: 1196737720

View in Genome Browser
Species Human (GRCh38)
Location X:118994357-118994379
Sequence ATGGACACCCAAAATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 5, 2: 74, 3: 144, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196737720 Original CRISPR ATGGACACCCAAAATGAGCA GGG Intronic
903820786 1:26100905-26100927 ATTTACACCCACAATGATCATGG - Intergenic
905232483 1:36522813-36522835 GTGGACACCCAAAAAGATAAAGG - Intergenic
905467893 1:38169359-38169381 ATGGAAACCCAAGATCAGTAAGG - Intergenic
906053764 1:42898094-42898116 ATGGACACCAAAAGTGAGTGGGG - Intergenic
906134600 1:43488536-43488558 ATGGCCTCACAAAATGAGCTGGG + Intergenic
906563804 1:46781753-46781775 ATGGACACCAAAAGCAAGCAGGG - Intronic
906923754 1:50092216-50092238 TTGGAAACACAAAAAGAGCATGG + Intronic
908098095 1:60761675-60761697 ATGGAAACTCCAAAAGAGCAAGG + Intergenic
909285440 1:73810728-73810750 ATGGAGACAGAAAATTAGCAAGG - Intergenic
909948148 1:81687461-81687483 ATGGACACCAAAAGTGAGCAGGG - Intronic
909981184 1:82103379-82103401 ATGGACACCAAAAGTAAGCTTGG - Intergenic
910738782 1:90492807-90492829 ATGGACACCAAAAGTCAGCAGGG - Intergenic
911678704 1:100689862-100689884 ATGGACACCAAAAGCGAGCAGGG - Intergenic
911689342 1:100814328-100814350 ATGGACACCAAAAGTGAGTAGGG + Intergenic
912176972 1:107171323-107171345 ATGGACATGGAAAATGAGCAAGG - Intronic
912615948 1:111100268-111100290 AAGGACACCAAAAGTGAGCAGGG - Intergenic
913143334 1:115963753-115963775 ATAGACACCAAATGTGAGCAGGG + Intergenic
913151562 1:116048922-116048944 ATGGACACAAAAAGTGAGCAGGG + Intronic
913463944 1:119119242-119119264 ATGGACACCAAAAGTGAGCAGGG + Intronic
914346267 1:146801322-146801344 ATGGACACCAAAAGAGAGCAGGG + Intergenic
914455281 1:147830990-147831012 ATGGACACCAAAAGTGAGCAGGG - Intergenic
914968171 1:152279868-152279890 ATGGAGACCAAAAGTGAGTAGGG + Intergenic
915887004 1:159732753-159732775 ATGGAAAACCAAAAAAAGCAGGG + Intergenic
916278373 1:163021036-163021058 ATGGAGACCAGAAAAGAGCAGGG - Intergenic
917250895 1:173059762-173059784 ATGGTAACCCAAAAAGATCATGG - Intergenic
917319191 1:173761055-173761077 ATGGACACCAAAAGCGAGCAGGG + Intronic
917898265 1:179514883-179514905 ATGGACACCAAAAGCGAGCAGGG - Intronic
917907790 1:179605193-179605215 ATGGACACCAAAAGCAAGCAAGG - Intronic
918273063 1:182921966-182921988 ATGGAAAACCAAAAAAAGCAGGG + Intronic
918278833 1:182982449-182982471 AAGGAAACTGAAAATGAGCAGGG - Intergenic
918635021 1:186764887-186764909 GTGACCACCCAGAATGAGCAGGG + Intergenic
918966502 1:191356531-191356553 ATGGAAAACAAAAATGAACAGGG - Intergenic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
920726763 1:208443549-208443571 ATGGACACCAAAAGTAAGCAGGG - Intergenic
921236951 1:213142194-213142216 ATGGAAAACAAAAAAGAGCAGGG - Intronic
921834717 1:219766054-219766076 ATGGACACCAAAAGTGAGCAGGG + Intronic
922658078 1:227403043-227403065 ATGGACACCAAAAGTGAGCAGGG + Intergenic
922927159 1:229359233-229359255 ATGGACACCAAAAGCGAGCAGGG - Intergenic
922995746 1:229958470-229958492 ATGGACACCAAAAGCAAGCAGGG - Intergenic
923177089 1:231477244-231477266 ATGTATACCCAAAATAAGCAGGG + Intergenic
923648444 1:235847716-235847738 ATGGACACCAAAAGCCAGCAAGG + Intronic
924321208 1:242852967-242852989 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1063578000 10:7279132-7279154 ATGGAAATCCAACATGACCAGGG + Intronic
1063723984 10:8616285-8616307 ATGGTGACCCAAAATTAGCCTGG + Intergenic
1063867300 10:10379745-10379767 ATGGCAACATAAAATGAGCATGG - Intergenic
1065311466 10:24419777-24419799 GTGGAAGCCCAAAATGTGCATGG - Intronic
1065470750 10:26079317-26079339 ATGGACACCAAAAGCAAGCAGGG - Intronic
1066145328 10:32552218-32552240 ATGGACACCAAAAGCAAGCAGGG - Intronic
1066542079 10:36458294-36458316 AGGGACATCAAAAAGGAGCATGG + Intergenic
1068480979 10:57587632-57587654 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1068815967 10:61313351-61313373 ATGGAAACCCAAAGAGAGCAAGG - Intergenic
1068820701 10:61375142-61375164 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1068924824 10:62525178-62525200 ATGGGCACCAAAAACAAGCAGGG - Intronic
1069386875 10:67891387-67891409 ACAGACACCTAAAATGTGCATGG - Exonic
1071062755 10:81592177-81592199 ATGGAAACCAAAAATGAGTGGGG + Intergenic
1071405621 10:85328159-85328181 ATGAACACCAAAAGTGAGCAGGG - Intergenic
1071892696 10:90029003-90029025 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1072815106 10:98499841-98499863 ATGGACACCAAAAGCAAGCAGGG + Intronic
1072933743 10:99692048-99692070 ATGTACACCCATTATGTGCAAGG + Intronic
1073701103 10:105927578-105927600 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1073872697 10:107884037-107884059 ATTGAAACCCAAAATGTGAATGG + Intergenic
1074224914 10:111475358-111475380 ATGGACACTCCAAATCAGAAAGG + Intergenic
1075660412 10:124191382-124191404 ATGAACACCAAAAGTGAGCAGGG - Intergenic
1075982546 10:126753682-126753704 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1077380168 11:2230175-2230197 ATGGAAACCAAAAGAGAGCAGGG + Intergenic
1077741985 11:4856390-4856412 ATGGAAAACCAAAAAAAGCAGGG + Intronic
1078531752 11:12141865-12141887 ATGGACAACCAATATGAAAAGGG + Intronic
1079207853 11:18432782-18432804 ATGGACACCAAAAGCGAGCTGGG - Intronic
1079273458 11:19011373-19011395 ATGGACATCAAAAGTGAGCAGGG - Intergenic
1079634136 11:22714195-22714217 ATGGAAACCAAAAGTGAGCAGGG + Intronic
1079753965 11:24232966-24232988 ATGGAAAACAAAAATGTGCAGGG - Intergenic
1080213448 11:29814578-29814600 ATGGAAACTAAAAAAGAGCAGGG - Intergenic
1080324321 11:31052172-31052194 ATGAACACCAAAAGTGAGAAGGG + Intronic
1080917608 11:36675711-36675733 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1081181076 11:39986359-39986381 ATGGAAACCAAAAAAAAGCAGGG + Intergenic
1081185676 11:40039469-40039491 ATGGAAACCAAAAAAAAGCAGGG + Intergenic
1081195450 11:40154524-40154546 ATGAACACCAAAAGTGAGCCAGG + Intronic
1083518214 11:63280782-63280804 ATGGAAACCAAAAGTGAGCAGGG - Intronic
1085387596 11:76165848-76165870 ATGGCCACCGAAAGGGAGCATGG - Intergenic
1085748069 11:79131858-79131880 ATGGACACCAAAAGCCAGCAGGG + Intronic
1085804200 11:79619474-79619496 AAGGACACCCAGGAAGAGCAAGG - Intergenic
1086554992 11:88098883-88098905 ATGAAGACCCAAAATGAAAATGG - Intergenic
1087503534 11:98991487-98991509 ATGGAAACCAAAAGTGAGCAGGG - Intergenic
1088137507 11:106576111-106576133 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1088239830 11:107761938-107761960 ATAGATACCAAAAGTGAGCAGGG + Intergenic
1088387853 11:109279776-109279798 ATGGACATCAAAAGCGAGCAGGG - Intergenic
1089900295 11:121975613-121975635 ATGGACACCAAAAGCAAGCAGGG + Intergenic
1089952696 11:122544786-122544808 ATGAACACCAAAAGTGAGCAGGG - Intergenic
1090545447 11:127761384-127761406 ATGGAAACCAAAAGTGAGCAGGG + Intergenic
1090564267 11:127970153-127970175 ATAGTCACCCAAAGAGAGCAAGG - Intergenic
1091210268 11:133852271-133852293 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1091867486 12:3853453-3853475 ATGGAAAGCAAAAAAGAGCAGGG + Intronic
1093261012 12:16938099-16938121 ATGGAAACCAAAAAACAGCAGGG - Intergenic
1093389796 12:18604214-18604236 ATGTACACCAAAAGCGAGCAGGG + Intronic
1093488506 12:19679457-19679479 ATGGACACCAAAAGTGAGCAGGG - Intronic
1093496671 12:19765386-19765408 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1093951735 12:25169991-25170013 ATGGATACCAAAAGCGAGCAGGG + Intronic
1094482115 12:30892857-30892879 ATGGAAAGCCAAAAAAAGCAGGG - Intergenic
1094501516 12:31025207-31025229 ATGGACACCAAAAGCAAGCAGGG + Intergenic
1094760180 12:33523050-33523072 ATGGAAAGCAAAAAAGAGCAGGG + Intergenic
1095247974 12:39944663-39944685 ATGGACACCAAAAGCAAGCAGGG - Intronic
1095732949 12:45524777-45524799 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1096346548 12:50852361-50852383 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1096348090 12:50868317-50868339 ATGGACACCAAAAGAGAGCAGGG + Intronic
1096957038 12:55536677-55536699 ATGTACACCAAAAGTGATCAGGG + Intergenic
1097295704 12:57960085-57960107 ACGGACACCAAAAGTGAGCAGGG + Intergenic
1097385757 12:58948562-58948584 ATGGACACCAAAAATGAGCAGGG - Intergenic
1097418994 12:59350526-59350548 ATGGAAAGCAAAAAAGAGCAGGG - Intergenic
1097642875 12:62203657-62203679 ATGGAAAGCCAAAAAAAGCAGGG - Intronic
1098207165 12:68123635-68123657 ATGGAAACCAAAAAAGAGCAGGG - Intergenic
1098982476 12:76972371-76972393 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1099088364 12:78275793-78275815 ATGGAAAGCAAAAAAGAGCAGGG - Intergenic
1099233951 12:80059941-80059963 TTGGGCACCCACAATGTGCAAGG + Intergenic
1099516610 12:83604570-83604592 ATGGACACCAAAAGCGTGCAGGG + Intergenic
1099540925 12:83906743-83906765 ATGGACAGTCAAAGTAAGCAGGG + Intergenic
1099777226 12:87149461-87149483 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1100115898 12:91303682-91303704 ATGGAAAGCAAAAAAGAGCAGGG + Intergenic
1100290795 12:93213067-93213089 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1100808506 12:98313068-98313090 ATGGAAACCAAAAAAAAGCAGGG + Intergenic
1101251588 12:102941477-102941499 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1101635066 12:106533598-106533620 ATGGACACCAAAAGTGAGCAGGG - Intronic
1101904475 12:108814623-108814645 GAGGCCACCCAAGATGAGCAGGG - Intronic
1102916521 12:116758144-116758166 ATGGACACCAAAAGCAAGCAGGG - Intronic
1104062480 12:125280501-125280523 ATGGACACTCAGATTGAGCAAGG - Intronic
1105337223 13:19484799-19484821 ATGGAAGCCAAAAGTGAGCAGGG - Intronic
1105908483 13:24837046-24837068 ATGGACACCAAAAACGAGCAAGG + Intronic
1105930961 13:25051374-25051396 ATGAACACCAAAAGTGAGCAGGG + Intergenic
1106072746 13:26428356-26428378 ATGGAAACCAAAAGAGAGCAAGG + Intergenic
1106937953 13:34745387-34745409 ATGGACACCAAAAACAAGCAGGG - Intergenic
1107335997 13:39355705-39355727 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1107755780 13:43621063-43621085 ATGGACACCAAAAACGAGCTGGG - Intronic
1108549457 13:51528683-51528705 ATGGAAACCAAAAAAGAGCAGGG + Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1108825765 13:54410137-54410159 ATGGACATCCAAAGCGAGCAGGG + Intergenic
1108831847 13:54488899-54488921 ATGGACACCAAAATTAAGCAGGG + Intergenic
1109213380 13:59561194-59561216 ATGGACACCAAACATGAGCAGGG - Intergenic
1109653360 13:65357380-65357402 ATGGAAACCAAAAGAGAGCAGGG + Intergenic
1109669651 13:65587482-65587504 ATGGAAAACAAAAATAAGCAGGG + Intergenic
1110144538 13:72174115-72174137 AGGGGCACCCAAAATAACCATGG + Intergenic
1110204608 13:72897634-72897656 ATGAACACCAAAAGCGAGCAGGG + Intronic
1110985306 13:81959331-81959353 AGAGAAAGCCAAAATGAGCAGGG + Intergenic
1111165558 13:84453655-84453677 ATGGACACCAAAAGTGAGTAGGG - Intergenic
1111590338 13:90338945-90338967 ATGGAAACCAAAAGAGAGCAGGG + Intergenic
1112035194 13:95491075-95491097 ATGGACACCAAAAGCGAGCAGGG - Intronic
1112364149 13:98742427-98742449 ATGGACACCCAAGCTGAGGGAGG - Intronic
1112747514 13:102543396-102543418 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1112945518 13:104921970-104921992 ATGGACACCAAAAGCAAGCAGGG + Intergenic
1113269744 13:108660594-108660616 ATGGACACCAAAAGGAAGCAGGG - Intronic
1113738706 13:112696585-112696607 CTGGAAGCCAAAAATGAGCACGG - Intronic
1114061184 14:19016915-19016937 ATGGAAAGCAAAAAAGAGCAGGG - Intergenic
1114101069 14:19383071-19383093 ATGGAAAGCAAAAAAGAGCAGGG + Intergenic
1114787177 14:25614261-25614283 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1115265227 14:31493498-31493520 ATGGACACCAAAAGCAAGCAGGG + Intronic
1115680519 14:35732571-35732593 ATGGACACCAAAAGCGAACAGGG + Intronic
1115695043 14:35887845-35887867 CTGGACACCTAGAATAAGCAGGG - Intronic
1115835286 14:37395835-37395857 ATGAACACCAAAAGTGAGCAGGG - Intronic
1116088797 14:40277515-40277537 ATGGACACAGAAAGTGAGCAGGG - Intergenic
1116223582 14:42118734-42118756 ATGGACACCAAAAACAAGCAGGG - Intergenic
1116253668 14:42520584-42520606 ATGGACACCAAAAAAGAACAGGG + Intergenic
1116335705 14:43653453-43653475 ATGAACACCAAAAGTGAGCAGGG + Intergenic
1116402028 14:44519361-44519383 CTGGAAACCAAAAATGAACAAGG - Intergenic
1116732195 14:48638002-48638024 ATGGACACCAAAAGTGAGCAAGG + Intergenic
1117112969 14:52477494-52477516 ATGGACACCAAAAGCGAGCAGGG + Intronic
1118225728 14:63897364-63897386 ATGAACAGCCAATATCAGCATGG - Intronic
1118535567 14:66759553-66759575 ATGGAAAACAAAAAAGAGCAGGG - Intronic
1119016952 14:71067464-71067486 ATGGACACAAAAAATGATAAAGG - Intronic
1119098672 14:71858271-71858293 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1120545566 14:85807463-85807485 ATGGATGACCAAAGTGAGCAAGG - Intergenic
1120972489 14:90219575-90219597 ATGGAAACCAAAAGAGAGCAGGG + Intergenic
1121318527 14:92976519-92976541 ATGGAAATCCAAAATGATAATGG - Intronic
1121496125 14:94392268-94392290 TCGGAAAGCCAAAATGAGCACGG - Intergenic
1121516378 14:94554497-94554519 ATGGACACCAAAAGTGGGCAGGG - Intergenic
1124386793 15:29215718-29215740 ATTGACACCAAAAGGGAGCAGGG - Intronic
1124418829 15:29498967-29498989 ATGGAAACCAAAAGAGAGCAGGG - Intronic
1125336577 15:38632352-38632374 ATAAGCACCTAAAATGAGCAGGG + Intergenic
1126880458 15:53089602-53089624 ATGGAAAACCAAAAAGAGCAGGG - Intergenic
1127003271 15:54535190-54535212 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1127355572 15:58195715-58195737 ATGGAAAACCAAAAAAAGCAGGG + Intronic
1128238947 15:66086993-66087015 CTGGACACCAAAAGCGAGCAGGG + Intronic
1129097389 15:73223602-73223624 ATGGACACCAAAAGCGAGCAGGG - Intronic
1129171694 15:73811935-73811957 ATGGAAACCCAATTTGAGCCAGG - Intergenic
1129642676 15:77396600-77396622 ATGGAAACCAAACAAGAGCAGGG + Intronic
1129747963 15:78038162-78038184 CTGGACACCCACCATGAGCCAGG + Intronic
1129928880 15:79391902-79391924 ATGGACACCAAAAGTAAGCAGGG - Intronic
1130419359 15:83728177-83728199 ATGGAAACCAAGAAAGAGCAGGG - Intronic
1131608354 15:93933790-93933812 ATGCAAATCCAAAATGTGCAAGG + Intergenic
1131781172 15:95861404-95861426 ATGGAGAGCCAAAATAAGAATGG - Intergenic
1132210080 15:100015182-100015204 ATAGACAGCAAAAGTGAGCAGGG - Intronic
1135901845 16:26467083-26467105 ATGGACACCAAACGTGAGCAGGG + Intergenic
1136990667 16:35149579-35149601 ATGGACACCACAAGTGAGCTGGG - Intergenic
1138979350 16:62248271-62248293 GTGGACACCCTAAATGTTCATGG + Intergenic
1139987713 16:70913946-70913968 ATGGACACCAAAAGAGAGCAGGG - Intronic
1142840957 17:2629903-2629925 ATGGACACCAAAAGCAAGCAGGG - Intronic
1143211082 17:5188070-5188092 ATGGGCACCCAAAAGCAGTAAGG - Intronic
1143991028 17:10961759-10961781 ATGGACACCGAAAGTGAGCAGGG + Intergenic
1144139462 17:12334693-12334715 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1144145201 17:12390770-12390792 ATGCACACCGAAAATGAACTTGG + Intergenic
1146086302 17:29833402-29833424 ATGGAAACCAAAAAAGAGCAAGG - Intronic
1146583602 17:34061695-34061717 ATGGATACCAAAAGTGAACACGG + Intronic
1146751242 17:35383053-35383075 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1147462982 17:40587218-40587240 ATGGACACCAAAAGTGTTCAGGG - Intergenic
1148408045 17:47437579-47437601 ATGGACACCAAAAGTGAGCAGGG - Intronic
1149414239 17:56442329-56442351 ATGCAGACACAAAAAGAGCAAGG + Intronic
1149885960 17:60340492-60340514 ATGGAAAGCCAAAAAAAGCAGGG - Intronic
1149943492 17:60896643-60896665 ATGGAAACCAAAAGTGAACAGGG - Intronic
1150026064 17:61675339-61675361 ATGGAAAGCCAAAAAAAGCAGGG + Intergenic
1150818563 17:68415835-68415857 ATGAACACCAAAAGTAAGCAGGG - Intronic
1150870832 17:68909482-68909504 ATGGACTCGCAAATTGGGCAGGG + Intronic
1151048593 17:70949784-70949806 ATGGACACCAAAAGTGAACGGGG + Intergenic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1153069289 18:1087366-1087388 ATAGACACCAAAAGCGAGCAGGG - Intergenic
1153168718 18:2291511-2291533 ATGGACACCAAAAGTGAGCAAGG - Intergenic
1153289020 18:3482135-3482157 ATGGACACCCAAAACGGGGCAGG + Intergenic
1153363581 18:4227031-4227053 ATGGAAACCAAAAAAGAGCACGG + Intronic
1153400674 18:4680940-4680962 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1153493359 18:5672181-5672203 AGTGAAACCCAAAATGAGAAGGG + Intergenic
1153965724 18:10180252-10180274 ATGCTCACCAAAAGTGAGCAGGG - Intergenic
1155948169 18:31878795-31878817 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1156011117 18:32499189-32499211 ATGGACACCAAAAGTGAGGAGGG - Intergenic
1156017957 18:32567464-32567486 ATAGACAGCCAAGATGAACAGGG + Intergenic
1156792869 18:40998806-40998828 ATGGACACCAAAAGAGAGCAGGG + Intergenic
1157073253 18:44434659-44434681 ATGGAAAGCAAAAAAGAGCAGGG - Intergenic
1157408451 18:47443739-47443761 AAGGCCACCCAAGGTGAGCAGGG - Intergenic
1157541052 18:48507309-48507331 ATGGACACCAAAAGTGATCAGGG + Intergenic
1157973009 18:52292740-52292762 AAGAACACCTCAAATGAGCATGG - Intergenic
1158756713 18:60333756-60333778 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1160267414 18:77352066-77352088 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1160405813 18:78645544-78645566 ATGGGCACCCACAGTGAGCACGG + Intergenic
1164091238 19:21954657-21954679 ATGGAAAACCAAAAAAAGCAGGG - Intronic
1164237884 19:23352778-23352800 ATGGACACCCAAAGCAAGCAGGG + Intronic
1164251964 19:23485322-23485344 ATGGACACCAAATGTAAGCAGGG + Intergenic
1164319930 19:24135254-24135276 ATGGACACCAAAAACAAGCAGGG - Intergenic
1166459837 19:42977344-42977366 GTGCACACCCAAATTGAGGAAGG - Intronic
1166477161 19:43137398-43137420 GTGCACACCCAAATTGAGGAAGG - Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166604046 19:44124834-44124856 ATGGACACCAAAAATGAGCAGGG - Intronic
1168395877 19:56048041-56048063 ATGGACACCAAAAGCGAGCAGGG - Intronic
1168437518 19:56332479-56332501 ATGGAAAACAAAAAAGAGCAGGG - Intronic
1168458213 19:56531932-56531954 ATGGACACCAAAAAGAAGCAGGG - Intergenic
924973042 2:148431-148453 ATGGAAACCAAAAAGGAGCAAGG - Intergenic
925414901 2:3662671-3662693 ATGGACACCCTAAATGCCCTGGG - Intronic
926560384 2:14410346-14410368 ATGGACATCAAAAGCGAGCAGGG + Intergenic
927328147 2:21830638-21830660 ATGGACACCAAAAGAGAGCAGGG - Intergenic
928469097 2:31555808-31555830 ATGTAAACCCAAAATTAGCCAGG + Intronic
928733913 2:34263324-34263346 ATGGACACCAAAAGTGAGCAGGG + Intergenic
928856171 2:35804971-35804993 ATGGACACTGAAAATGAGCAGGG + Intergenic
929388403 2:41439764-41439786 ATGGATGCCAAAAAAGAGCAAGG - Intergenic
930469772 2:51797339-51797361 ATGATCACCAAAAATGAGCAGGG + Intergenic
930941927 2:57024101-57024123 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
931524963 2:63143239-63143261 ATGGACACCAAAAGCGAGCAGGG - Intronic
931548077 2:63410712-63410734 ATGGACACCAAAGGTGAGTAGGG + Intronic
932100357 2:68894087-68894109 ATAGACACCAAAAGGGAGCAGGG - Intergenic
932270507 2:70404895-70404917 ATGGACACCAAAAGTGAGCAGGG + Intergenic
933715170 2:85354686-85354708 ATGGAAACCCAAAAGAAGTACGG - Intronic
934167804 2:89310729-89310751 ATGGAAAGCAAAAAAGAGCAGGG + Intergenic
935954172 2:108358719-108358741 ATGGACACCAAAAGTGAGCAGGG + Intergenic
936164654 2:110109372-110109394 ATGGACACCAAAAGCAAGCAGGG + Intronic
937058071 2:118956313-118956335 ATGGACACCAAAAGTGAGCAGGG + Intronic
937069043 2:119048453-119048475 ATGGACACCAAAAGCCAGCAGGG - Intergenic
937480505 2:122253479-122253501 ATGGACACCAAAAGCAAGCAAGG + Intergenic
937521944 2:122722220-122722242 ATGGACACCAAAAGCAAGCAGGG + Intergenic
937529473 2:122810530-122810552 ATGGACACCAAAAGCTAGCAGGG + Intergenic
937605980 2:123802378-123802400 ATGGAAAGCAAAAAAGAGCAGGG - Intergenic
937756698 2:125547816-125547838 ATGGAAAACCAACAAGAGCAAGG + Intergenic
937781776 2:125846981-125847003 ATGGACACCAAAAGTGAGCAGGG - Intergenic
938037835 2:128051010-128051032 ATGGACACCAAAAGAGAGCAGGG - Intergenic
939247332 2:139642944-139642966 ATAGAAAACCAAAAAGAGCAGGG - Intergenic
939912608 2:148001928-148001950 ATGGAAAGCAAAAAAGAGCAGGG + Intronic
940034501 2:149299866-149299888 ATGGACACCAAAAGCAAGCAGGG - Intergenic
940172162 2:150841171-150841193 ATGGACACCAAAAGTGAGCAGGG - Intergenic
940581875 2:155590686-155590708 ACGTACACACAAACTGAGCATGG + Intergenic
940618480 2:156081932-156081954 ATGGACACCAAAAGCAAGCAGGG - Intergenic
940709195 2:157142142-157142164 AAGGACACCAAAAGTGAGCAGGG - Intergenic
940784784 2:157969791-157969813 ATGGACACCAAAAGTAAGCAGGG - Intronic
942001263 2:171650031-171650053 ATGGAAACCAAAAAAGAGCAGGG - Intergenic
942154527 2:173114209-173114231 ATGGACACCAAAAGCAAGCAGGG - Intronic
942726286 2:179011292-179011314 ATGGACACCAAAAATGAGCAGGG + Intronic
942998051 2:182289041-182289063 ATGGACAACCAGAAGTAGCAAGG - Intronic
943095621 2:183425542-183425564 ATGGTGAGCCAAAATGAACATGG - Intergenic
943602845 2:189941986-189942008 CTGGAAACCAAAAAAGAGCAGGG + Intronic
943891088 2:193288361-193288383 ATGGACACCAAAAGTGAGCAGGG - Intergenic
944121366 2:196244162-196244184 ATGGATGTCCAAAATGAGTAAGG + Intronic
945463785 2:210143260-210143282 ATGGAAACCAAAAGAGAGCAGGG - Intronic
945764027 2:213950867-213950889 AAGGTCCCCCAAAATTAGCAGGG - Intronic
945825952 2:214719929-214719951 ATGGACACCAAAAGCGAGCAGGG + Intergenic
947439451 2:230106172-230106194 ATGGAAACCAAAAAAGAGCAGGG - Intergenic
947941016 2:234054912-234054934 ATGGACACACAAAAAAGGCATGG - Intronic
948576930 2:238958470-238958492 ATGGACACCAAAAGCAAGCAGGG + Intergenic
948999309 2:241603219-241603241 AGACACAGCCAAAATGAGCAAGG - Intronic
948999331 2:241603319-241603341 AGACACAGCCAAAATGAGCAAGG - Intronic
948999351 2:241603419-241603441 AGACACAGCCAAAATGAGCAAGG - Intronic
948999372 2:241603519-241603541 AGACACAGCCAAAATGAGCAAGG - Intronic
1168730674 20:77021-77043 ATGGACATCAAAAGAGAGCATGG + Intergenic
1169335935 20:4757305-4757327 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1169397934 20:5251731-5251753 ATGGTAACCAAAAAAGAGCAGGG - Intergenic
1169517237 20:6331175-6331197 AATGACACCAAAAGTGAGCAGGG - Intergenic
1169671133 20:8104072-8104094 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1170245549 20:14218333-14218355 ATGGACACCAAAAGTGAGCAGGG - Intronic
1170375670 20:15697875-15697897 ATGGACACCAAAAGCAAGCAGGG - Intronic
1170418998 20:16173834-16173856 ATGGACACTCCAAATGAACCAGG - Intergenic
1170862940 20:20126033-20126055 ATGGACACCAAAAGCAAGCAGGG - Intronic
1171081397 20:22189086-22189108 ATGGACACCAAAAGTGAGAAGGG - Intergenic
1171751591 20:29056300-29056322 ATGGTAACCAAAAAAGAGCAAGG - Intergenic
1171790746 20:29521576-29521598 ATGGTAACCAAAAAAGAGCAAGG + Intergenic
1171856962 20:30355262-30355284 ATGGTAACCAAAAAAGAGCAAGG - Intergenic
1172520502 20:35562621-35562643 ATGGAGGTCCAAGATGAGCAGGG + Intergenic
1172857003 20:38012630-38012652 ATGAACTCCCAAGATGACCAGGG - Exonic
1174651746 20:52131541-52131563 ATGGAAACCAAAAAAGAGCAGGG + Intronic
1175308306 20:57993216-57993238 ATGAACAGCCAACATGATCAGGG - Intergenic
1176065875 20:63194458-63194480 AAGGAAACACAAAATGAGAACGG - Intergenic
1176736343 21:10550404-10550426 ATGGAAGCCCAAAGTGAGCAGGG + Intronic
1177121966 21:17148761-17148783 ATGGAAACCAAAAAAGAGCAAGG + Intergenic
1177474165 21:21597055-21597077 ATGGAAAACTAAAAAGAGCAAGG - Intergenic
1177995151 21:28088102-28088124 ATGGACACCAAAAGCCAGCAGGG - Intergenic
1178801881 21:35803239-35803261 ATGGACACCAAAAGCGAGCAGGG + Intronic
1179327477 21:40362317-40362339 ATGGACAAGCAAATTCAGCATGG - Intronic
1179432917 21:41336892-41336914 ATGGAAACCAAAAGAGAGCAGGG - Intronic
1180479669 22:15739527-15739549 ATGGAAAGCAAAAAAGAGCAGGG - Intergenic
1180914386 22:19475002-19475024 ATGGACACCAAGAGTCAGCATGG - Intronic
1182388413 22:29967964-29967986 ATGGACAAACAAAATGTGAATGG - Intronic
1183247696 22:36706528-36706550 TTGGACTCCCAAAATGGGCTGGG + Intergenic
1183417584 22:37691382-37691404 AGGGACAGCCAAGCTGAGCAAGG - Exonic
1183858000 22:40649184-40649206 ATAGAGACCCAAGATGAGAAAGG - Intergenic
949765556 3:7522060-7522082 ATGAACCTCCAAAATGAGCTGGG - Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950708935 3:14801678-14801700 AGGGACACCCAGAAGGAACAGGG + Intergenic
950820096 3:15748012-15748034 ATGGACACCAAATGTGAGCAGGG - Intronic
951180892 3:19657130-19657152 ATGGAAATCAAAAGTGAGCAGGG + Intergenic
951316070 3:21191084-21191106 ATGGCCACCCTAAAACAGCAAGG + Intergenic
951572282 3:24077229-24077251 ATGGACACCAAAAGTGAGCAGGG - Intergenic
951617964 3:24569030-24569052 ATGGAAACCAAAAAAAAGCAGGG + Intergenic
951795265 3:26531831-26531853 ATGGAAACCAAAAAAAAGCATGG - Intergenic
951852112 3:27152833-27152855 ATGGACACCAAAAGTGAGCAAGG + Intronic
952657890 3:35808242-35808264 ATGTACACCCACAATGGGGAGGG - Intergenic
953723690 3:45379364-45379386 ATGGACACCAAAAGTGTGCAGGG - Intergenic
953804287 3:46054529-46054551 ATGGACACTCAAAAGGACGAGGG + Intergenic
953866623 3:46588910-46588932 ATGGACGCCGAAAGCGAGCAGGG + Intronic
954525194 3:51263739-51263761 ATGGAAAACCAAAAAAAGCATGG + Intronic
954563332 3:51577668-51577690 ATGGAAAACCAAAAAAAGCAGGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955859899 3:63317553-63317575 ATGGACACCAAAAGTGAGCAGGG - Intronic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
957907090 3:86570866-86570888 TTGGGAACCAAAAATGAGCAGGG + Intergenic
958969725 3:100598805-100598827 ATGGACACCAAAAGTGAGCAGGG - Intergenic
959330541 3:104999078-104999100 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
959899264 3:111641318-111641340 ATGGACACCAAAAGCGAGCAGGG + Intronic
959947922 3:112147117-112147139 ATGGAAAACAAAAAAGAGCAGGG - Intronic
959998277 3:112702047-112702069 ATGGACACCAAAAGTGAGAAGGG + Intergenic
960067142 3:113386218-113386240 ATGGTAACCAAACATGAGCAGGG - Intronic
960824146 3:121765800-121765822 ATGAAAAACCAAAAGGAGCAGGG - Intergenic
961407376 3:126690563-126690585 ATGGACACCAAAAGCAAGCAGGG + Intergenic
962465775 3:135657352-135657374 ATGGAAACTAAAAAAGAGCAGGG + Intergenic
963179754 3:142341742-142341764 ATGGAAACCAAAATGGAGCAGGG + Intronic
963764942 3:149324779-149324801 ATGGAACCCCAAAGTGATCATGG + Intronic
964601042 3:158501670-158501692 ATGGACACCAACAGTGAGCAGGG - Intronic
965052527 3:163669499-163669521 AAGGACACCAAAAGTGAGCAGGG - Intergenic
965296424 3:166953315-166953337 ATGGACTTCAAAAGTGAGCAGGG - Intergenic
966117484 3:176483318-176483340 ATGGACACCAAAAGCAAGCAGGG - Intergenic
967203075 3:187092321-187092343 ATGGAAACCAAAAGAGAGCAGGG - Intergenic
967661662 3:192118414-192118436 ATGGCCACAGAAAATGACCACGG - Intergenic
968125447 3:196156222-196156244 ATGGACACCAAAAGTGAGCAGGG - Intergenic
970346530 4:15158468-15158490 ATGGACACCAAAAGTCAGCAGGG - Intergenic
970658425 4:18258348-18258370 ATGGACACCAAAAGCAAGCAGGG - Intergenic
970714859 4:18909115-18909137 ATGGAAACCAAAAAAGAGAATGG + Intergenic
971182911 4:24347575-24347597 ATGGACAACAAAAGCGAGCAGGG - Intergenic
972188863 4:36566745-36566767 ATGAACACCAAATGTGAGCAGGG - Intergenic
972199038 4:36691024-36691046 ATGGAGAACAAAAAAGAGCAAGG - Intergenic
972224853 4:37000943-37000965 ATGTACACCCAAAATGGCCTTGG - Intergenic
972931104 4:44072251-44072273 ATGGGCACCCAAAGTCAGGAGGG + Intergenic
973179373 4:47249747-47249769 ATGGACACCGAAAGCAAGCAGGG - Intronic
973782648 4:54302976-54302998 ATGGACACCAAAATCGAGCAGGG + Intergenic
974410580 4:61536705-61536727 ATGGAAAACAAAAAAGAGCAGGG - Intronic
974574054 4:63693709-63693731 ATGCACACCCACATTGAGGAGGG + Intergenic
975034167 4:69660384-69660406 ATGGACACCAAAAGCAAGCAGGG + Intergenic
975517499 4:75262496-75262518 ATGGACAACAAAAGTGAGAAGGG + Intergenic
975674998 4:76818572-76818594 ATGGAAACTAAAAAGGAGCAAGG - Intergenic
976556399 4:86455476-86455498 ATGGACACCAAAAGTGAGCAGGG + Intronic
976686128 4:87817550-87817572 ATGGACACCAAAAGTGAGCAGGG - Intergenic
977019789 4:91745007-91745029 ATGAACACCAAAAGTGAGCAGGG - Intergenic
977148779 4:93481823-93481845 AGGGACAGCAAAAATGAGCAGGG + Intronic
977388003 4:96369504-96369526 ATGAAAACCAAAAGTGAGCAGGG - Intergenic
977746981 4:100560578-100560600 ATGGACATCAAAAACAAGCAGGG + Intronic
977854981 4:101878277-101878299 ATGGAAACCAAAAAAGAGCAGGG + Intronic
978401536 4:108335950-108335972 ATGGACACCAATCATGAGGAGGG + Intergenic
978726477 4:111975744-111975766 ATGGACACCAAAAGCGAGCAGGG - Intergenic
978999231 4:115197556-115197578 ATGGGCACCAAAAGTGAGCAAGG - Intergenic
979201078 4:117978878-117978900 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
979381889 4:120016512-120016534 ATGGACACCAAAAGCAAGCAGGG - Intergenic
979383552 4:120036830-120036852 ATGGACACCCACAGTGAGAAGGG - Intergenic
979675139 4:123401592-123401614 ATGGATCCCCAAAATCAACATGG + Exonic
979995610 4:127427139-127427161 ATGGACACCAAAAGTGAGCAGGG + Intergenic
980087007 4:128401919-128401941 ATGGACACCAAAAGTGAGCAGGG - Intergenic
980087592 4:128407707-128407729 ATGGACACCAAAAGCAAGCAGGG - Intergenic
980091158 4:128444272-128444294 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
980347392 4:131638606-131638628 ATGGAAACCAAAAGAGAGCAAGG + Intergenic
980523808 4:133963161-133963183 ATGGACACCAAAATTGAGCAGGG + Intergenic
980688705 4:136263044-136263066 ATGGAAAACAAAAATGAGTAGGG + Intergenic
981461575 4:145018768-145018790 ATGGACACCAAAAGTGAGCAGGG + Intronic
981600572 4:146483792-146483814 ATGGTAACCAAAAAAGAGCAGGG + Intronic
981662747 4:147186194-147186216 ATGGAAAGCAAAAAAGAGCAGGG + Intergenic
982013345 4:151128064-151128086 ATAGACAGACAAACTGAGCATGG + Intronic
982608606 4:157545076-157545098 CTGGAAACCAAAAAAGAGCAGGG - Intergenic
983021226 4:162677473-162677495 ATGAACACCAAAAAAGAGCAGGG + Intergenic
983155207 4:164338579-164338601 ATGGAAACAAAAAAAGAGCAGGG + Intronic
983544672 4:168950908-168950930 ATAGGCACCAAAAGTGAGCAGGG - Intronic
983547936 4:168982236-168982258 ATGGAAAACAAAAAGGAGCAGGG + Intronic
983831780 4:172337089-172337111 ATGGAAAACAAAAAAGAGCAGGG - Intronic
984266456 4:177503247-177503269 ATGAACACCAAAAGAGAGCAGGG - Intergenic
984323855 4:178226981-178227003 ATGGACAGCAAAAGTGAGCAGGG + Intergenic
984721930 4:182980570-182980592 ATGGACACCAAAAGTGAGCAGGG + Intergenic
984903198 4:184602985-184603007 ATGGAAAGCAAAAAAGAGCAGGG + Intergenic
985085061 4:186304902-186304924 AATGAGACCCAAAATGAGAAAGG - Intergenic
985093109 4:186383757-186383779 ATGGACACCAAAGACGAGCAGGG + Intergenic
985309696 4:188583731-188583753 CTGAAAACACAAAATGAGCAGGG - Intergenic
985433974 4:189910621-189910643 ATGGTAACCAAAAAGGAGCAAGG - Intergenic
986286036 5:6359924-6359946 GTGGACACGCAGAGTGAGCACGG + Intergenic
986519813 5:8602702-8602724 AGGGACACACAGAATGTGCAAGG + Intergenic
986634234 5:9804061-9804083 ATGGACACCAAAAGAGAGTAGGG + Intergenic
988785365 5:34561779-34561801 GTGGACTCACAAAATGACCAAGG - Intergenic
988902437 5:35747505-35747527 ATGGACACAAAAAGTGAGCAGGG + Intronic
989083842 5:37654770-37654792 ATGGAAAGCCAAAAAAAGCAGGG - Intronic
989494657 5:42098716-42098738 ATGGAAACCAAAAAAGAGTAAGG - Intergenic
989495369 5:42105633-42105655 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
989533604 5:42537977-42537999 ATGGACACCAAAAGCCAGCAGGG - Intronic
989786998 5:45344616-45344638 ATGCAAATCCAAAATAAGCAGGG + Intronic
990712627 5:58602662-58602684 ATGAACACCAAAAGTGAGCAGGG - Intronic
991164889 5:63554202-63554224 AAGAACACCTAAAATGAGCATGG + Intergenic
991387202 5:66103179-66103201 ATGGACACCAAAAACAAGCAGGG + Intergenic
993420142 5:87691493-87691515 ATGGTAACCCAAAGGGAGCAGGG - Intergenic
993442687 5:87976261-87976283 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
993964948 5:94348637-94348659 ATGGACACCAAAAGTGACCAGGG + Intronic
993964983 5:94349115-94349137 ATGGACACCAAAAGCAAGCAGGG + Intronic
994330074 5:98494147-98494169 ATGGACACCAAAAACAAGCAAGG + Intergenic
994715378 5:103315337-103315359 TTGGACACTCAAAATGTGCCAGG - Intergenic
995475269 5:112541274-112541296 ATGGAAAGCAAAAATAAGCAGGG + Intergenic
995694392 5:114863887-114863909 AGGAACACCAAAATTGAGCAGGG - Intergenic
995955533 5:117771792-117771814 ATGGACACCAAAAGTGAGCAGGG + Intergenic
996032171 5:118717543-118717565 ATGGACACCAAAAGCAAGCAGGG + Intergenic
996123840 5:119703188-119703210 AAGGACACCAAAAGCGAGCATGG - Intergenic
996288739 5:121827181-121827203 ATGGACACCAAAAGTAAGCAGGG - Intergenic
996325611 5:122269363-122269385 ATGGACACCAAAAGCAAGCAGGG + Intergenic
996427286 5:123328460-123328482 ATGGAAACCAAAAGTGAGCAGGG - Intergenic
996678538 5:126204159-126204181 ATGGACACCAAAAGTGAGCAGGG + Intergenic
997670424 5:135666807-135666829 TTGGCCCTCCAAAATGAGCAAGG - Intergenic
997761133 5:136448404-136448426 ATGGACACCAAAAGTGAGCAGGG + Intergenic
998777024 5:145615226-145615248 ATGGAGACCAAAAGCGAGCAGGG - Intronic
998941085 5:147282612-147282634 ATGGACACCAAAAGCGAGGAGGG + Intronic
999484491 5:151981988-151982010 ATGGACACCAAAAGTGAGCAGGG - Intergenic
999818829 5:155203946-155203968 ATGGACCCCAAAAGTGATCAGGG + Intergenic
1000779953 5:165467501-165467523 ATGGACACCAAAAGCAAGCAGGG + Intergenic
1002485718 5:179534904-179534926 ATGGATACCCAAAAAGGGAAGGG + Intergenic
1002814071 6:661974-661996 ATGGACACCAAAAGAGAGCAGGG + Intronic
1003029220 6:2587392-2587414 AGGGACACCAAAAGCGAGCAGGG - Intergenic
1003063357 6:2879596-2879618 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1003451089 6:6232272-6232294 ATGGACACCAAAAGCGAGCAGGG + Intronic
1003582222 6:7350079-7350101 ATGGACACCAAAAGCGAGCAGGG + Intronic
1003711775 6:8600880-8600902 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1004798123 6:19112741-19112763 ATGGAAACCATAAAAGAGCAAGG - Intergenic
1005072707 6:21876513-21876535 ATGGACACCGAAAGTGAGCAGGG + Intergenic
1005812587 6:29528815-29528837 CTGGAGGCTCAAAATGAGCAGGG - Intergenic
1008248872 6:49212462-49212484 ATGGAAAGCCAAAAAGAGCAAGG + Intergenic
1008256335 6:49304657-49304679 ATGGACACAAAAAACGAGCAGGG + Intergenic
1008927324 6:56900735-56900757 GTGCACTCCCAAAGTGAGCATGG + Intronic
1008973374 6:57396471-57396493 ATGGACACCAAAAGTGAGCAGGG - Intronic
1009042186 6:58191797-58191819 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009162277 6:60298015-60298037 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1009218023 6:60946031-60946053 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009453379 6:63827094-63827116 ATGGACACCAAAAGCGAGCAGGG + Intronic
1009605651 6:65864083-65864105 ATGGAAACCAAAAAAAAGCAGGG - Intergenic
1010008801 6:71027006-71027028 ATGGACACCAAAAGCTAGCAGGG - Intergenic
1010017210 6:71119278-71119300 ATGGAAACCAAAAGTGAGCAAGG - Intergenic
1010670287 6:78678324-78678346 ATGGAAACCAAAAAAAAGCAGGG + Intergenic
1010887930 6:81266855-81266877 ATGGTAACCAAAAAAGAGCAGGG + Intergenic
1011327356 6:86163785-86163807 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1011328875 6:86181996-86182018 ATGGACACCAAAATTGATCAGGG - Intergenic
1011346436 6:86374274-86374296 ATATACACACAAAATGAGAAGGG - Intergenic
1011789518 6:90883594-90883616 ATGGACAACAAAAGTGAGCAGGG - Intergenic
1012050159 6:94331251-94331273 ATGGACACTTAAAAAGAGTAGGG + Intergenic
1012156164 6:95821859-95821881 ATGGACACCACAAGTGAGTAGGG + Intergenic
1012538110 6:100324372-100324394 ATGGAAAACAAAAAGGAGCAGGG - Intergenic
1012600401 6:101090036-101090058 ATGGAAACCAAAAGTGAGCAAGG - Intergenic
1012684790 6:102232510-102232532 ATGGACACCAAAAACAAGCAGGG - Intergenic
1012738029 6:102975658-102975680 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1012965844 6:105671739-105671761 ATGGAAACCAAAAGCGAGCAGGG + Intergenic
1013379693 6:109555830-109555852 ATGGAAAGCCAAAAAAAGCAGGG - Intronic
1013702813 6:112794812-112794834 TTGGCCACACAACATGAGCAGGG + Intergenic
1013900799 6:115154312-115154334 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1014304639 6:119725599-119725621 ATAGACACCAAAAGTGAGCAGGG - Intergenic
1014531182 6:122561734-122561756 ATGGACACCAAAAGCGAGCAGGG - Intronic
1014739239 6:125127769-125127791 ATGGACACCAAAAGCAAGCAGGG + Intronic
1015289089 6:131518083-131518105 ATGGAAACTAAAAGTGAGCAGGG - Intergenic
1015350050 6:132207919-132207941 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1015434357 6:133168721-133168743 ATGCCCACCCAAACTGAGGAGGG + Intergenic
1015565787 6:134569242-134569264 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1015591582 6:134827768-134827790 ATGGACACCTACCATGAGCCTGG + Intergenic
1015849591 6:137558270-137558292 ATGGACACCTAAAGCAAGCAGGG - Intergenic
1015903391 6:138090633-138090655 TTGGACACCTAAAATGAGCAAGG + Exonic
1016197249 6:141359613-141359635 ATGGACACCAGAAGTGAGCAGGG - Intergenic
1016544614 6:145207091-145207113 AAGGACACCCAAAATGAAGGTGG - Intergenic
1017190282 6:151646502-151646524 ATGGACACCAAAAGTGAGTAGGG - Intergenic
1018009606 6:159657614-159657636 ATGGACACCAAAAATGACCAGGG + Intergenic
1018087070 6:160311980-160312002 ATGGAAACCAAAAAAGAGTAGGG - Intergenic
1018806075 6:167260917-167260939 ATGGAAAGCAAAAAAGAGCAGGG + Intergenic
1020332171 7:7030565-7030587 ATGGAAACCAAAAGTGAGCAGGG - Intergenic
1020584528 7:10049651-10049673 ATGGAAAGCAAAAAAGAGCAGGG + Intergenic
1020614791 7:10444791-10444813 ATGGAAACCAAAAAAAAGCAGGG + Intergenic
1020773930 7:12430156-12430178 ATGGACAGCAAAAAAAAGCAGGG - Intergenic
1020923710 7:14297191-14297213 ATGGCCTCACAAAATGAGCTAGG - Intronic
1021189658 7:17605130-17605152 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1021202715 7:17743380-17743402 ATGGAAAACAAAAAAGAGCAAGG + Intergenic
1021323314 7:19238635-19238657 ATGGACACCAAAGGTGAGCAGGG - Intergenic
1021481052 7:21117500-21117522 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1021502071 7:21343171-21343193 ATGGAAAGCCAAAAAAAGCAGGG - Intergenic
1022898381 7:34776519-34776541 ATGGAAACCACAAAAGAGCAGGG - Intronic
1023211522 7:37810514-37810536 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1023701473 7:42895426-42895448 ATGGACACCAAAAGTGAACAGGG + Intergenic
1023748760 7:43349676-43349698 ATGGACACCAAAAGTGAGCAGGG - Intronic
1023850650 7:44148219-44148241 ATGGCAACCCAAAGTGAGTAAGG + Intronic
1024545710 7:50515746-50515768 ATGGACACCAAAAGTAAGCAGGG + Intronic
1024917016 7:54513366-54513388 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1026534202 7:71226850-71226872 AAGGAGACCCAAAAGGACCACGG - Intronic
1027297983 7:76798155-76798177 ATGGGTTCCCAAGATGAGCAGGG - Intergenic
1027699426 7:81451245-81451267 ATGGACACCAAAAACTAGCTGGG + Intergenic
1027783962 7:82555703-82555725 ATGGAAATAAAAAATGAGCAGGG + Intergenic
1028078838 7:86548767-86548789 ATGGAAAGCCAAAAAAAGCAGGG + Intergenic
1028365482 7:90024736-90024758 ATGGAAACCAAAAAACAGCAGGG + Intergenic
1028532595 7:91854140-91854162 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1028929237 7:96394705-96394727 ATGGAAACCAAAAGGGAGCAGGG - Intergenic
1028962028 7:96759977-96759999 ATGGACGCCAAAAGCGAGCAGGG - Intergenic
1028993250 7:97073284-97073306 ATAGATACCAAAACTGAGCAGGG - Intergenic
1030325408 7:108213589-108213611 ATGGACACCAAAAGCAAGCAGGG + Intronic
1030936204 7:115587211-115587233 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1032415119 7:131729781-131729803 ATGGCAACCCAAAAAGAGCTTGG + Intergenic
1033259169 7:139827279-139827301 ATGGACACCAAAAGCCAGCAGGG - Intronic
1033950150 7:146774714-146774736 ATTGACTCCCAAAATGCGTACGG + Intronic
1034306763 7:150049493-150049515 ATGGAAACCCGGAAGGAGCAGGG - Intergenic
1034800081 7:154051149-154051171 ATGGAAACCCGGAAGGAGCAGGG + Intronic
1037868900 8:22472701-22472723 ATGGACCCCCAAAAACAGAAAGG - Intronic
1038693779 8:29786749-29786771 ATGGTGAGCAAAAATGAGCATGG - Intergenic
1039641682 8:39229519-39229541 ATGGACACCAAAAGTGAGCAGGG + Intronic
1040519854 8:48167179-48167201 ATGGAAAGCCAAAAAAAGCAGGG - Intergenic
1040635467 8:49268597-49268619 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1040773823 8:51014653-51014675 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1041227981 8:55719045-55719067 ATAGACACCAAAAGTGAGCAGGG + Intronic
1041293457 8:56331017-56331039 ATGGACACCAAAATCGAGCAGGG - Intergenic
1041637323 8:60158376-60158398 ATGGACACCAAAAGCAAGCAGGG + Intergenic
1041877773 8:62710540-62710562 ATGGACACTAAAAGTGAGCAGGG - Intronic
1042122615 8:65505196-65505218 ATGGACATCAAAAGTGAGCAGGG - Intergenic
1043040982 8:75261507-75261529 ATAGACACCAAAAATGGGCAGGG + Intergenic
1043816677 8:84810809-84810831 ATGGACACCAAAAGTGAACAGGG - Intronic
1043967620 8:86496463-86496485 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1044524666 8:93239089-93239111 AATGAAACTCAAAATGAGCATGG - Intergenic
1044955793 8:97478297-97478319 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1045732827 8:105262339-105262361 ATGGACAACAAAAAAAAGCAAGG - Intronic
1045833295 8:106490517-106490539 ATGCACACACAAAATTAGCTGGG - Intronic
1047032570 8:120898258-120898280 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1047332357 8:123902627-123902649 ATGGACACCAAAAGCGAGCAGGG - Intronic
1047896546 8:129372951-129372973 AGGGACACCAAAGCTGAGCATGG + Intergenic
1050502901 9:6317182-6317204 ATGGACACCAAAAGCCAGCAGGG + Intergenic
1050643958 9:7699352-7699374 ATGGAAACCATAAAAGAGCAGGG - Intergenic
1051029947 9:12661323-12661345 ATGGAAACCAAAAAAGAGCAAGG + Intergenic
1051362892 9:16296762-16296784 ATGGACACCAAAAGTGAGCCGGG + Intergenic
1052006464 9:23355765-23355787 ATGGACACCAAAAGGAAGCAGGG - Intergenic
1052247169 9:26349622-26349644 ATGGAAACCAAAAGCGAGCAGGG + Intergenic
1052363809 9:27589317-27589339 CTGGCCACCCAAGATGGGCATGG + Intergenic
1054911789 9:70461583-70461605 ATATACACACAAAATTAGCAAGG - Intergenic
1055346790 9:75348164-75348186 ATGGACACCAAAAGCTAGCAGGG - Intergenic
1055905596 9:81290581-81290603 ATGGACACCAAAAGCTAGCATGG - Intergenic
1056016349 9:82392257-82392279 ATGGGCACACACAATGACCAGGG - Intergenic
1056125750 9:83535423-83535445 ATGGAGCCCCAAAATAAGTAGGG - Intronic
1056322526 9:85450205-85450227 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1057004026 9:91539871-91539893 ATGGACACCGAAAGCAAGCAGGG + Intergenic
1057119251 9:92556653-92556675 ATAGACACCAAAAGTGAGCAGGG - Intronic
1057302034 9:93892161-93892183 AAGGCCAGCCAAAATGAGCTGGG - Intergenic
1058156531 9:101522534-101522556 ATGGAAAGCAAAAGTGAGCAGGG - Intronic
1058308206 9:103469506-103469528 ATGTACACCAAAAGCGAGCAGGG - Intergenic
1058410665 9:104727198-104727220 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1058622995 9:106903743-106903765 ATGGACACCAAAAGTGAGCAGGG - Intronic
1058770870 9:108230184-108230206 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1059609377 9:115876435-115876457 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1060034640 9:120244242-120244264 ATGGACAGCCAGAAGGTGCATGG - Intergenic
1185498364 X:576887-576909 ATGGACACCCAGAAGAGGCAGGG + Intergenic
1186599552 X:11022616-11022638 ATGGAAAGCCAAAAACAGCAGGG - Intergenic
1187218994 X:17305926-17305948 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1187681587 X:21772446-21772468 ATGGATACCAAAAGTGAACAGGG + Intergenic
1187711356 X:22057760-22057782 AGTGACACCCAAAATGGACAAGG - Intronic
1187773399 X:22728650-22728672 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1188805828 X:34588836-34588858 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1189413868 X:40796741-40796763 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1189665214 X:43347923-43347945 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1189878949 X:45469291-45469313 ATGAACACCAAAAGCGAGCAGGG - Intergenic
1189931919 X:46021409-46021431 ATGGACACCTAAAGCAAGCAGGG + Intergenic
1190015400 X:46822544-46822566 ATGGAAACAGAAAAAGAGCAGGG + Intergenic
1190449142 X:50560045-50560067 ATGGACACCAAAATCGAGCAGGG + Intergenic
1190631995 X:52397007-52397029 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1190895272 X:54612242-54612264 ATGGACACCAAAAGCAAGCAGGG - Intergenic
1190899352 X:54654011-54654033 TTGGAAACCAAAAAAGAGCAGGG + Intergenic
1191111784 X:56809578-56809600 ATGGAAAGCCAAAAAAAGCAGGG - Intergenic
1191903376 X:66062497-66062519 ATGGGCACCAAAAGTGAGCAGGG - Intergenic
1191906089 X:66092078-66092100 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1191994274 X:67074111-67074133 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1192371628 X:70518935-70518957 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1192820431 X:74638974-74638996 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1192895446 X:75438480-75438502 ATGGACACTAAAAATATGCAGGG - Intronic
1192913445 X:75630197-75630219 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1192920331 X:75699242-75699264 ATGGAAAACAAAAAAGAGCAAGG + Intergenic
1193068823 X:77285157-77285179 ATGGAAAGCCAAAAACAGCAGGG + Intergenic
1193077219 X:77366867-77366889 ATGGACACTAAAAGCGAGCAGGG + Intergenic
1193157097 X:78185484-78185506 ATGGACACCAAAATCAAGCAGGG + Intergenic
1193253197 X:79317606-79317628 ATGGACACCAAAAGTGAGCGGGG - Intergenic
1193578719 X:83234695-83234717 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1193590154 X:83379549-83379571 ATGGACACCAAAACTGAGTAAGG - Intergenic
1193590894 X:83387542-83387564 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1194136783 X:90153900-90153922 ATGGAAACCAAAGAGGAGCAGGG + Intergenic
1194237397 X:91401105-91401127 ATGGACACCAAAGGTGAGCAGGG + Intergenic
1194285393 X:92004699-92004721 ATGGAAACCCAAAATGAGCAAGG - Intronic
1194354055 X:92858517-92858539 ATGGAAACCAAAAGTGAGCAAGG + Intergenic
1194370701 X:93067534-93067556 TTGGAAAACCAAAAAGAGCAAGG + Intergenic
1194574798 X:95598996-95599018 ATGGAAACCTAAAAAGAGCAGGG + Intergenic
1194596563 X:95866318-95866340 ATGGAAACCAAGAGTGAGCAGGG + Intergenic
1195019307 X:100810831-100810853 ATGGACACCAAAAACGAGCAGGG - Intergenic
1195344712 X:103938481-103938503 ATGGAAAGCAAAAATAAGCAGGG - Intronic
1195415409 X:104614812-104614834 ATGGAAACCAAAAAAGAGCAGGG - Intronic
1195984967 X:110619859-110619881 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1196219098 X:113090236-113090258 ATGGAAAGCAAAAGTGAGCAGGG + Intergenic
1196465042 X:115962949-115962971 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1196590296 X:117479647-117479669 AGGGACACCAAAAGAGAGCAGGG - Intergenic
1196675550 X:118417008-118417030 ATGGACACCAAAAGCGAACAGGG - Intronic
1196737720 X:118994357-118994379 ATGGACACCCAAAATGAGCAGGG + Intronic
1197132652 X:123022312-123022334 ATGGACACCAAAAGCAAGCAGGG + Intergenic
1197302729 X:124801413-124801435 ATGGAAAGCAAAAAAGAGCAGGG - Intronic
1197319345 X:125008200-125008222 ATGGAAAGCAAAAAAGAGCAGGG + Intergenic
1197668879 X:129254029-129254051 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1197671387 X:129282184-129282206 ATGGAGAGCAAAAGTGAGCAGGG - Intergenic
1197953893 X:131925718-131925740 ATGCACACCAAAAGCGAGCAGGG + Intergenic
1198168953 X:134085712-134085734 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1198753774 X:139961249-139961271 ATGGAAAGCCAAAAAAAGCAGGG + Intronic
1199477556 X:148262604-148262626 ATGCACAACCACAAGGAGCAAGG - Intergenic
1199521301 X:148739451-148739473 ATGGACACCAAAAGCAAGCAGGG - Intronic
1199821547 X:151454099-151454121 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1199950580 X:152702819-152702841 ATGGACACCCATCATCTGCAAGG + Intergenic
1199952851 X:152719074-152719096 ATGGACACCCATCATCTGCAAGG + Intergenic
1199956832 X:152749374-152749396 ATGGACACCCATCATCTGCAAGG - Intergenic
1199959102 X:152765642-152765664 ATGGACACCCATCATCTGCAAGG - Intergenic
1200045513 X:153398769-153398791 AGGGATACCCAGGATGAGCAGGG + Intergenic
1200334524 X:155335476-155335498 ATGTACAGCCCATATGAGCATGG - Intergenic
1200415040 Y:2900822-2900844 ATGGACAACAAAAGTGACCAGGG + Intronic
1200416820 Y:2920720-2920742 ATGGACAGCAAAAAAAAGCAGGG - Intronic
1200602964 Y:5229238-5229260 ATGGAAACCCAAAATGAGCAAGG - Intronic
1200662409 Y:5975536-5975558 ATGGAAACCAAAAGTGAGCAAGG + Intergenic
1200678493 Y:6179427-6179449 TTGGAAAACCAAAAAGAGCAAGG + Intergenic
1201437096 Y:13971190-13971212 ATGGAAAACAAAAAAGAGCAGGG - Intergenic