ID: 1196740180

View in Genome Browser
Species Human (GRCh38)
Location X:119017725-119017747
Sequence AAGACTCCCCCCGACGGCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196740180_1196740182 18 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740182 X:119017766-119017788 TGCAATAATATCTTAACAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 258
1196740180_1196740183 19 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740183 X:119017767-119017789 GCAATAATATCTTAACAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 200
1196740180_1196740184 20 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740184 X:119017768-119017790 CAATAATATCTTAACAGAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 258
1196740180_1196740185 21 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740185 X:119017769-119017791 AATAATATCTTAACAGAAGGGGG 0: 1
1: 0
2: 3
3: 32
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196740180 Original CRISPR AAGACTCCCCCCGACGGCAG TGG (reversed) Exonic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
907800637 1:57761858-57761880 AAGACTCCCCCAGACAGCCAGGG + Intronic
916523137 1:165583710-165583732 AAGACTCCCTCTGACTTCAGAGG + Intergenic
918851356 1:189694501-189694523 CAGCCTCCCCTCGATGGCAGAGG + Intergenic
923090251 1:230735235-230735257 AAATCTCGCCCCGACTGCAGCGG + Intergenic
1073454033 10:103625977-103625999 AAGACTCTCCCCTGCTGCAGAGG + Intronic
1076605026 10:131683714-131683736 CAGACCCGCCCCGACGGCAAGGG + Intergenic
1080401831 11:31943362-31943384 AAGACTCCCCAGGAAGGCATAGG + Intronic
1084392767 11:68889570-68889592 AACAGTTCCCCAGACGGCAGTGG + Intergenic
1095462642 12:42458750-42458772 AAGGCACCCCCCGCAGGCAGGGG + Exonic
1096523676 12:52198375-52198397 AAGCCTCCCCAAGATGGCAGAGG + Intergenic
1111820999 13:93214998-93215020 AAGACTCCCCTAGAAGCCAGAGG + Intergenic
1122597069 14:102901158-102901180 AGGACTCCCCCACACAGCAGGGG - Intronic
1125735091 15:41919254-41919276 GAGCCTCCCCCAGAAGGCAGCGG - Exonic
1127703497 15:61525040-61525062 AGGTCTCACCCCGAAGGCAGAGG - Intergenic
1128078778 15:64843969-64843991 AAGCCTCACCCCCACAGCAGGGG + Intronic
1138186882 16:54983722-54983744 TGGACTCCCCCAGAAGGCAGCGG + Intergenic
1138491981 16:57382339-57382361 CAGGCTCCCCCCGACGCCAAAGG + Exonic
1139328882 16:66172414-66172436 AAGACTCCCCCAGGAGACAGAGG + Intergenic
1142883947 17:2901253-2901275 AGGACTCCCCCAGGTGGCAGAGG + Intronic
1146157529 17:30536318-30536340 AAGACTCCCCTTTAAGGCAGGGG - Intergenic
1152450491 17:80375849-80375871 AAGCCTCCACCCCACGCCAGAGG + Exonic
1154082916 18:11275964-11275986 GAGAGTCCACACGACGGCAGTGG + Intergenic
1156481029 18:37436534-37436556 GAAACTCCCCCAGAGGGCAGAGG - Intronic
1158560139 18:58506570-58506592 AAGACTCACCAGGAGGGCAGAGG + Intronic
944869075 2:203891915-203891937 AAGACTCCTCCTGAGGTCAGAGG - Intergenic
946146207 2:217732986-217733008 AAGACTCCTCCCTAGGGCTGAGG - Intronic
1175839940 20:62020269-62020291 AAGAGCCCCCCCACCGGCAGAGG - Intronic
1177737404 21:25108654-25108676 AAGACTGCCCCTGACTTCAGAGG + Intergenic
1185413588 22:50698090-50698112 CAGACACCCCACGACGGCAAGGG - Intergenic
954003205 3:47573827-47573849 TAGCCTCCCCATGACGGCAGAGG - Intronic
989102756 5:37836921-37836943 AAAACTCCCCGCGTCGCCAGAGG + Intronic
1026254328 7:68697629-68697651 AAGAAGCCCCCCGACCGAAGGGG + Intergenic
1035269553 7:157711487-157711509 AGGACTCCCCCGGGCTGCAGGGG - Intronic
1035329574 7:158087581-158087603 AAGACTCCCTCCTTCGTCAGGGG - Intronic
1035534537 8:381156-381178 CAGACTCTCCCCGTCAGCAGCGG + Intergenic
1056708747 9:88973003-88973025 GAGACTCCCCCCACCGGCAGGGG - Intergenic
1058412371 9:104747874-104747896 AAGCCTTCACCCGACGGGAGGGG + Intronic
1062358216 9:136175113-136175135 AAAACTCTCCCCTAGGGCAGAGG - Intergenic
1196740180 X:119017725-119017747 AAGACTCCCCCCGACGGCAGTGG - Exonic