ID: 1196740180

View in Genome Browser
Species Human (GRCh38)
Location X:119017725-119017747
Sequence AAGACTCCCCCCGACGGCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196740180_1196740182 18 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740182 X:119017766-119017788 TGCAATAATATCTTAACAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 258
1196740180_1196740184 20 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740184 X:119017768-119017790 CAATAATATCTTAACAGAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 258
1196740180_1196740185 21 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740185 X:119017769-119017791 AATAATATCTTAACAGAAGGGGG 0: 1
1: 0
2: 3
3: 32
4: 280
1196740180_1196740183 19 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740183 X:119017767-119017789 GCAATAATATCTTAACAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196740180 Original CRISPR AAGACTCCCCCCGACGGCAG TGG (reversed) Exonic