ID: 1196740183

View in Genome Browser
Species Human (GRCh38)
Location X:119017767-119017789
Sequence GCAATAATATCTTAACAGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 200}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196740178_1196740183 21 Left 1196740178 X:119017723-119017745 CCCCACTGCCGTCGGGGGGAGTC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1196740183 X:119017767-119017789 GCAATAATATCTTAACAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 200
1196740179_1196740183 20 Left 1196740179 X:119017724-119017746 CCCACTGCCGTCGGGGGGAGTCT 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1196740183 X:119017767-119017789 GCAATAATATCTTAACAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 200
1196740176_1196740183 25 Left 1196740176 X:119017719-119017741 CCTTCCCCACTGCCGTCGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 148
Right 1196740183 X:119017767-119017789 GCAATAATATCTTAACAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 200
1196740170_1196740183 29 Left 1196740170 X:119017715-119017737 CCCACCTTCCCCACTGCCGTCGG 0: 1
1: 0
2: 0
3: 19
4: 157
Right 1196740183 X:119017767-119017789 GCAATAATATCTTAACAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 200
1196740181_1196740183 13 Left 1196740181 X:119017731-119017753 CCGTCGGGGGGAGTCTTCTTGTA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1196740183 X:119017767-119017789 GCAATAATATCTTAACAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 200
1196740180_1196740183 19 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740183 X:119017767-119017789 GCAATAATATCTTAACAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 200
1196740172_1196740183 28 Left 1196740172 X:119017716-119017738 CCACCTTCCCCACTGCCGTCGGG 0: 1
1: 0
2: 0
3: 29
4: 239
Right 1196740183 X:119017767-119017789 GCAATAATATCTTAACAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196740183 Original CRISPR GCAATAATATCTTAACAGAA GGG Exonic