ID: 1196740184

View in Genome Browser
Species Human (GRCh38)
Location X:119017768-119017790
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 258}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196740181_1196740184 14 Left 1196740181 X:119017731-119017753 CCGTCGGGGGGAGTCTTCTTGTA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1196740184 X:119017768-119017790 CAATAATATCTTAACAGAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 258
1196740178_1196740184 22 Left 1196740178 X:119017723-119017745 CCCCACTGCCGTCGGGGGGAGTC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1196740184 X:119017768-119017790 CAATAATATCTTAACAGAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 258
1196740180_1196740184 20 Left 1196740180 X:119017725-119017747 CCACTGCCGTCGGGGGGAGTCTT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1196740184 X:119017768-119017790 CAATAATATCTTAACAGAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 258
1196740176_1196740184 26 Left 1196740176 X:119017719-119017741 CCTTCCCCACTGCCGTCGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 148
Right 1196740184 X:119017768-119017790 CAATAATATCTTAACAGAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 258
1196740179_1196740184 21 Left 1196740179 X:119017724-119017746 CCCACTGCCGTCGGGGGGAGTCT 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1196740184 X:119017768-119017790 CAATAATATCTTAACAGAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 258
1196740172_1196740184 29 Left 1196740172 X:119017716-119017738 CCACCTTCCCCACTGCCGTCGGG 0: 1
1: 0
2: 0
3: 29
4: 239
Right 1196740184 X:119017768-119017790 CAATAATATCTTAACAGAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 258
1196740170_1196740184 30 Left 1196740170 X:119017715-119017737 CCCACCTTCCCCACTGCCGTCGG 0: 1
1: 0
2: 0
3: 19
4: 157
Right 1196740184 X:119017768-119017790 CAATAATATCTTAACAGAAGGGG 0: 1
1: 0
2: 3
3: 32
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type