ID: 1196741941

View in Genome Browser
Species Human (GRCh38)
Location X:119032620-119032642
Sequence GTGGGGAGACTGGCTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196741932_1196741941 7 Left 1196741932 X:119032590-119032612 CCGTGTCAAAAAAAAAAAAAAAC 0: 12
1: 2402
2: 102829
3: 91733
4: 118619
Right 1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG No data
1196741931_1196741941 29 Left 1196741931 X:119032568-119032590 CCTGGGAAACAAGAGCAAAACTC 0: 151
1: 10431
2: 22274
3: 31450
4: 25085
Right 1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196741941 Original CRISPR GTGGGGAGACTGGCTGGGAA GGG Intergenic
No off target data available for this crispr