ID: 1196746586

View in Genome Browser
Species Human (GRCh38)
Location X:119076518-119076540
Sequence TTGACATTTTAATTGACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196746586_1196746590 11 Left 1196746586 X:119076518-119076540 CCAAAAGTCAATTAAAATGTCAA No data
Right 1196746590 X:119076552-119076574 TTTTTGCAAAGAGAGAGATGGGG No data
1196746586_1196746589 10 Left 1196746586 X:119076518-119076540 CCAAAAGTCAATTAAAATGTCAA No data
Right 1196746589 X:119076551-119076573 ATTTTTGCAAAGAGAGAGATGGG No data
1196746586_1196746588 9 Left 1196746586 X:119076518-119076540 CCAAAAGTCAATTAAAATGTCAA No data
Right 1196746588 X:119076550-119076572 CATTTTTGCAAAGAGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196746586 Original CRISPR TTGACATTTTAATTGACTTT TGG (reversed) Intergenic
No off target data available for this crispr