ID: 1196746589

View in Genome Browser
Species Human (GRCh38)
Location X:119076551-119076573
Sequence ATTTTTGCAAAGAGAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196746586_1196746589 10 Left 1196746586 X:119076518-119076540 CCAAAAGTCAATTAAAATGTCAA No data
Right 1196746589 X:119076551-119076573 ATTTTTGCAAAGAGAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196746589 Original CRISPR ATTTTTGCAAAGAGAGAGAT GGG Intergenic
No off target data available for this crispr