ID: 1196746772

View in Genome Browser
Species Human (GRCh38)
Location X:119078109-119078131
Sequence CACTGAAGAGGTTTTACGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196746772_1196746782 30 Left 1196746772 X:119078109-119078131 CCAAACGTAAAACCTCTTCAGTG No data
Right 1196746782 X:119078162-119078184 TCACCTGAAAGCCATCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196746772 Original CRISPR CACTGAAGAGGTTTTACGTT TGG (reversed) Intergenic