ID: 1196748154

View in Genome Browser
Species Human (GRCh38)
Location X:119090061-119090083
Sequence GTGGGGAAACTGACTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 1, 2: 0, 3: 41, 4: 511}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196748146_1196748154 -4 Left 1196748146 X:119090042-119090064 CCTGTAACAATGACTACCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 112
Right 1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG 0: 1
1: 1
2: 0
3: 41
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196748154 Original CRISPR GTGGGGAAACTGACTGGGGA AGG Intronic
900637651 1:3673877-3673899 GTGGGAACACGGACTGGGGAGGG + Intronic
903047048 1:20572574-20572596 GGTGGGAAACTTACAGGGGATGG + Intergenic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
903407083 1:23106826-23106848 GTGGGAGAACAGACTGTGGAGGG - Intronic
903468510 1:23568587-23568609 GTGAGGAAATTGACTAGGGGAGG - Intergenic
904286661 1:29457190-29457212 GAGGACAAACTGACAGGGGAGGG - Intergenic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
904796364 1:33059229-33059251 GAGGGGGAATTGACTGGGAAGGG + Intronic
904823787 1:33261777-33261799 TTGGGGAAACTGAAGTGGGAAGG + Intronic
905239616 1:36573148-36573170 GTGGGGACACTGTGTGGGGGAGG + Intergenic
905435048 1:37950181-37950203 GTGGGGAATCTGAGAGGGGGTGG + Intergenic
905703385 1:40036241-40036263 GTGGGAAAACTTTCTGGGGATGG + Intergenic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
906766686 1:48440509-48440531 GTGGGGATTCATACTGGGGATGG - Intronic
907842349 1:58170159-58170181 GTGGGGATCCATACTGGGGATGG - Intronic
908339421 1:63161306-63161328 GTGGGGAGACAGATTGGGGCTGG + Intergenic
909359413 1:74743687-74743709 GTGGGGAGCCATACTGGGGATGG + Intronic
909473368 1:76054621-76054643 GTGGGGAAATTGACTGGGGAAGG + Intergenic
910504330 1:87932505-87932527 GTGGGGAAGCTGACATGGTATGG + Intergenic
911019644 1:93374089-93374111 GTGGGGAGGATGATTGGGGAAGG - Intergenic
911551534 1:99287695-99287717 GTGTGGAAAATGAATGGGTATGG + Intronic
912021304 1:105111540-105111562 GTGGGGATCCATACTGGGGATGG - Intergenic
913369505 1:118082828-118082850 TGGGGGAAAGTGACTGAGGAAGG + Intronic
913469525 1:119174819-119174841 GTGGGGATCCATACTGGGGATGG - Intergenic
913540931 1:119820347-119820369 GTGGGAAGACTGACTGGGAAAGG - Intergenic
914942336 1:152034394-152034416 GTGAGGAAACGGACAGGAGAAGG + Intronic
915260571 1:154674010-154674032 GTGGGGATCCATACTGGGGATGG - Intergenic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
916114439 1:161475087-161475109 GTGGGGATCCATACTGGGGATGG - Intergenic
916208616 1:162339768-162339790 GTGGGGTAACTAAGTGGGGTAGG + Intronic
916277045 1:163006267-163006289 GTGGGGAAACTGACTGGCAGTGG + Intergenic
916939534 1:169664531-169664553 GTGGGGATCCATACTGGGGATGG - Intronic
917086135 1:171307373-171307395 GTGGGGATCCATACTGGGGATGG - Intergenic
917279884 1:173370371-173370393 GTGGGGATCCATACTGGGGATGG - Intergenic
917281162 1:173379232-173379254 GTGGGGATCCATACTGGGGACGG - Intergenic
917445790 1:175104995-175105017 GTGGGGATCCATACTGGGGATGG + Intronic
917624517 1:176831967-176831989 GTGGTAAAAGTGAATGGGGAAGG + Intronic
919558658 1:199092779-199092801 GTGGGGATCCATACTGGGGATGG - Intergenic
920659196 1:207901158-207901180 ATGAGGATACTGACTGGGAATGG - Intronic
921019703 1:211224708-211224730 GTGGGGATCCATACTGGGGATGG - Intergenic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
921587715 1:216967174-216967196 GTGGGGAATATCAATGGGGAGGG - Intronic
921856941 1:219996781-219996803 GAGGGGTGACTTACTGGGGAAGG - Intronic
923631109 1:235649940-235649962 GTGGGGGCCCAGACTGGGGAAGG + Exonic
924113877 1:240726736-240726758 GTGGGGAATTGGACTGGAGATGG + Intergenic
924237603 1:242012226-242012248 GTCTGGAAGCTGGCTGGGGAAGG + Intergenic
1063321693 10:5057716-5057738 GTGGGGATCCATACTGGGGATGG + Intronic
1063390266 10:5645712-5645734 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1063390394 10:5646368-5646390 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1064443908 10:15376674-15376696 GTGGGTTAACTGGCTGGGCATGG - Intergenic
1064603560 10:17016324-17016346 GTGGGGATCCATACTGGGGAAGG + Intronic
1064979908 10:21155746-21155768 GAGAGAAAACTGACTGGGCAAGG + Intronic
1066614565 10:37282110-37282132 GTGGGGATCCATACTGGGGATGG + Intronic
1066667812 10:37803346-37803368 GTGAGGACACAGTCTGGGGAAGG - Intronic
1067769349 10:49112138-49112160 TTGGGGAACCTGACTGGGGTAGG - Intronic
1067964093 10:50889380-50889402 ATGGGGAAATTGACTGGAGTAGG + Intergenic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1068500323 10:57835200-57835222 GTGGGGATCCATACTGGGGATGG - Intergenic
1069365077 10:67687917-67687939 GTGGGGATCCATACTGGGGATGG + Intronic
1069497541 10:68919414-68919436 CTGGGGATACTGACTGGGACGGG - Intronic
1069799761 10:71074856-71074878 GTGGGGGAACTGAGAGGAGATGG - Intergenic
1070978886 10:80628540-80628562 GAGGGCAAAGTGAATGGGGAAGG + Intronic
1071399591 10:85256417-85256439 GAGGGGAAACTGAAATGGGAGGG + Intergenic
1071399723 10:85257376-85257398 TTGGGGAAAGTGCCTGGGGAGGG - Intergenic
1071892234 10:90022888-90022910 TGGGGGATACTGACTGGGAATGG + Intergenic
1072174884 10:92910460-92910482 GTGGGGAAATTGCCTAGGAAAGG + Intronic
1072223742 10:93349044-93349066 GTCAGGAAAATGACTGGGGTGGG + Intronic
1072371647 10:94770856-94770878 GTGGGGATCCATACTGGGGATGG + Intronic
1072900621 10:99403604-99403626 GTCGGGAATCTGACTGTGGTTGG - Exonic
1073269878 10:102253302-102253324 GTGGGGGAACTAACAGGGAAGGG - Intronic
1073759562 10:106614996-106615018 TTTGGGAAATTGACAGGGGAAGG - Intronic
1074184229 10:111087082-111087104 GGGTGGAGACTGATTGGGGAGGG + Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074742638 10:116499924-116499946 GTGGGGATCCATACTGGGGATGG + Intergenic
1075256035 10:120926663-120926685 GGATGGAAACTGAGTGGGGAGGG + Intergenic
1076785562 10:132748166-132748188 GGGAGGGAACTGACTGGGGCGGG - Intronic
1078329283 11:10406024-10406046 GTGGTGTCACTGGCTGGGGATGG + Intronic
1079731204 11:23939069-23939091 GTGGGGATCCATACTGGGGATGG + Intergenic
1079811646 11:25004793-25004815 GTGGGGATCCATACTGGGGATGG + Intronic
1080794979 11:35554693-35554715 GTGGGGTAACTGAATGCTGAGGG - Intergenic
1081146013 11:39563189-39563211 GTGGGGATCCATACTGGGGATGG - Intergenic
1081421440 11:42877483-42877505 GTGGGGATCCATACTGGGGATGG - Intergenic
1081504799 11:43704899-43704921 GTGGGCAAACTGAGTGGGTCAGG - Intronic
1081780485 11:45707598-45707620 GTGTGGAGATTGACTGGGGGTGG - Intergenic
1082086479 11:48054504-48054526 GTGAGGAAACAGACTTGGAAAGG + Intronic
1083186111 11:61018862-61018884 GTGGGGAAAATGGATGTGGACGG + Intronic
1083969726 11:66067500-66067522 GTGGTGAAACTGGCTGTGGATGG + Exonic
1084729915 11:71066238-71066260 GTGGGGAAGTTGGCGGGGGAGGG + Intronic
1085238143 11:75031059-75031081 ATGGGGAAAGTGTCTGGGGCTGG + Intergenic
1086174944 11:83880099-83880121 GTCAGGAAGCTGACTGTGGATGG + Intronic
1086317405 11:85609005-85609027 GTGGGGATCCATACTGGGGATGG - Intronic
1087075015 11:94120692-94120714 GTGGGGATCCATACTGGGGATGG - Intergenic
1087624906 11:100585278-100585300 GTAGGGGGACTGACTTGGGATGG - Intergenic
1088492560 11:110401893-110401915 GTGGGGATCCATACTGGGGATGG - Intergenic
1088664948 11:112085319-112085341 CTGGGCAAACCGACTGGTGATGG + Exonic
1088900649 11:114114310-114114332 GAGGGAAACCTGACTGGGGAGGG + Intronic
1089098100 11:115936573-115936595 GTGGGGAAAATGTCTGGAGAAGG + Intergenic
1089501357 11:118933437-118933459 GTGAGGAAACTGCTTGGTGAAGG + Intronic
1089560427 11:119340657-119340679 GAGGGGAAAGGGGCTGGGGAGGG - Intronic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1089694194 11:120206598-120206620 GTGGGGATACTGAGTGGAAAGGG - Intergenic
1090349820 11:126100875-126100897 GTGGGAAAAGAGACTGGGGCTGG + Intergenic
1091743308 12:2975267-2975289 TAGGAGAAACTGACTGGGGGCGG - Intronic
1091770197 12:3146328-3146350 GTGGGGAGACTGTGTGGAGATGG + Intronic
1091847839 12:3670941-3670963 GCAGGGATACTGACTGAGGATGG + Intronic
1091937855 12:4447504-4447526 GCTGGTAAACTGAATGGGGAGGG + Intergenic
1092218272 12:6697273-6697295 GTGGGGAAGGTGAGTGGGAAAGG - Exonic
1092277992 12:7076706-7076728 GTGAGAAAACTACCTGGGGATGG - Intergenic
1092283969 12:7118140-7118162 GTGGGGAGACAGGCTGGGGTGGG + Intergenic
1092472324 12:8790780-8790802 GTGGGGATCCATACTGGGGATGG - Intergenic
1093345267 12:18033793-18033815 GTGGGGATCCATACTGGGGATGG - Intergenic
1093580560 12:20780779-20780801 GTGGGGATCCATACTGGGGATGG + Intergenic
1093703838 12:22253392-22253414 GTGGGGAAAATGGCTTGAGATGG - Intronic
1094338085 12:29383247-29383269 GTGGGGATCCATACTGGGGATGG + Intergenic
1095750003 12:45699223-45699245 TTGGGGAAACTGGGTGGGAATGG + Intergenic
1096656621 12:53096566-53096588 GGCGGGACACTGCCTGGGGAAGG + Intergenic
1096870502 12:54589365-54589387 AAGGGGAAAATGCCTGGGGAGGG + Intergenic
1097153274 12:56994917-56994939 GAGGGGGAACTGGCTGGGGGTGG + Intronic
1097701736 12:62827465-62827487 GTGGGAAGGCTGACTTGGGAAGG - Intronic
1099161289 12:79244756-79244778 GTGTGGAAACTTAGCGGGGAAGG - Intronic
1099376269 12:81898943-81898965 GTGGGGATCCATACTGGGGACGG - Intergenic
1099393984 12:82115697-82115719 ATGGGGAAAATCACTGGGAAGGG + Intergenic
1100209815 12:92389109-92389131 GTGGGGATCCACACTGGGGATGG - Intergenic
1102409299 12:112703386-112703408 TTGGGGAATCTGACTAAGGATGG - Intronic
1102465740 12:113130035-113130057 GTGGGGAGCCTGCCTGGGGGAGG - Intronic
1103339211 12:120212267-120212289 TTGGGGATGCTGGCTGGGGAAGG + Exonic
1103863880 12:124036066-124036088 GTGGGGGGATTGACTGGGAAGGG - Intronic
1103879546 12:124155472-124155494 ATGGGGAAACTGTTGGGGGAAGG - Intronic
1103903977 12:124318010-124318032 GAGGGGAAACTGACAAAGGATGG + Intergenic
1104306203 12:127612766-127612788 GTGGGGATCCATACTGGGGATGG - Intergenic
1104655901 12:130573852-130573874 TTGGGGGAACTTGCTGGGGATGG - Intronic
1105762507 13:23527343-23527365 GTGGGGATCCATACTGGGGATGG - Intergenic
1106833527 13:33610672-33610694 GTGGGGGCACTCACTGGGGCTGG + Intergenic
1106939769 13:34764996-34765018 GTGGGGAAAACAAGTGGGGAGGG + Intergenic
1107111004 13:36698218-36698240 GCGGGGAAACTGGCAGAGGAAGG + Intergenic
1107679540 13:42834245-42834267 GAGGGGAAGCTGATTTGGGAGGG - Intergenic
1107851346 13:44576314-44576336 GAGGGGAAAGTGAATGGCGAAGG - Exonic
1108848620 13:54702751-54702773 GTGGGGATCCATACTGGGGATGG - Intergenic
1112538395 13:100283302-100283324 GTGGGGATCCATACTGGGGATGG - Intronic
1112686525 13:101834699-101834721 GTTGGGAAACAGATTGGTGAAGG + Intronic
1115174248 14:30544305-30544327 CTAGGGAAACTGACTGGGGCTGG + Intergenic
1117764035 14:59061352-59061374 GTGGGGAGACAGAGTGGGTAAGG - Intergenic
1117989099 14:61416343-61416365 GGGAGGAAATTGACTGGGCATGG - Intronic
1118058669 14:62110928-62110950 GTGAGGAAAGTCACTTGGGAGGG - Exonic
1118309225 14:64680514-64680536 ATGGGGAAAGTGACTGGGGCTGG - Intergenic
1118632829 14:67722104-67722126 GAGGGGGCAGTGACTGGGGAGGG - Intronic
1118895214 14:69940196-69940218 GTGGGGAAGATGGCTGGGGTTGG - Intronic
1118961238 14:70535395-70535417 GGGAAGAAACTGACTGGGAAGGG + Intergenic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1119950406 14:78738675-78738697 GTGGGGAAAAAGAATGGGGTGGG - Intronic
1120198812 14:81515503-81515525 GTGGGGATCCATACTGGGGACGG - Intronic
1120944574 14:89982124-89982146 GTGGGGCAAGGGAGTGGGGAGGG - Intronic
1121666759 14:95678118-95678140 CTGTGGAAACTGACTGGCTAGGG + Intergenic
1122896765 14:104761570-104761592 GTGAGGAAACTGCCTGAGGCTGG + Intronic
1122970825 14:105151547-105151569 GTGGGGCAACTCGCTGGGGATGG - Intronic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1125762156 15:42104071-42104093 GTGTGGGAAGTGATTGGGGAAGG + Intergenic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1126883361 15:53123078-53123100 GTGGGGAAAGTGCCTGGTGGAGG + Intergenic
1128514469 15:68333804-68333826 GTGGGGACAGAGGCTGGGGAGGG - Intronic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1131264774 15:90909509-90909531 GAGGGGCACTTGACTGGGGAGGG + Intronic
1131411225 15:92209806-92209828 GTGGGGATCCATACTGGGGATGG - Intergenic
1132622681 16:875214-875236 GTGGGGATGCTGAAAGGGGAGGG - Intronic
1132711671 16:1271623-1271645 GTGGGTAAAGGGCCTGGGGACGG + Intergenic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1134357058 16:13492159-13492181 GTGAGGAAATTGACTAGGGCTGG - Intergenic
1134489065 16:14682121-14682143 TTGGGGAAACTGGCTGGGCATGG - Intronic
1135174301 16:20214584-20214606 GTGGGGAAACTGCAAGGGGATGG + Intergenic
1136030770 16:27501243-27501265 GTGCGGAACCTGTCTGAGGAAGG - Exonic
1136289346 16:29262092-29262114 GTGTGGGATCTGACTTGGGAAGG + Intergenic
1136923631 16:34351229-34351251 GGGGGGAAGATGTCTGGGGAGGG - Intergenic
1136980942 16:35060577-35060599 GGGGGGAAGATGTCTGGGGAGGG + Intergenic
1138110189 16:54317644-54317666 GTGGAGGTACTGACCGGGGAGGG + Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1139406508 16:66723236-66723258 GTGGGGAAGCTGAATGTTGAGGG - Exonic
1141511335 16:84514222-84514244 CTGGGGGAACTGAGTGGGGCAGG - Intronic
1143172126 17:4936427-4936449 GTGGTTAGACTGGCTGGGGATGG - Intergenic
1143614637 17:8042554-8042576 GTGGGGGAACTGACTAGGGGAGG - Intronic
1143775220 17:9194975-9194997 GAGGGGAAACTGACTTGTGCAGG - Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145416044 17:22714927-22714949 GTGAGGAAACAGGCTGTGGATGG - Intergenic
1145761761 17:27429534-27429556 GTGGGGAAGCTGCCTGGGCATGG - Intergenic
1146104551 17:30021158-30021180 GTGAGGAATATGACTGGGGAAGG + Intronic
1146428264 17:32764658-32764680 GAGTGGAAGCTGACTGGGGGTGG - Intronic
1146650511 17:34603374-34603396 GTGGGGAAACTGAGGCGAGATGG + Intronic
1149589601 17:57818717-57818739 CTGGGGAAACTGACAAGAGAAGG - Intergenic
1150603038 17:66667115-66667137 GTGGGGGAAGGGACTGGGCAGGG - Intronic
1151173908 17:72271153-72271175 GTGGGGATACTGAATGCAGAGGG - Intergenic
1151568028 17:74910854-74910876 GTGGGGATCCATACTGGGGATGG - Intergenic
1152184564 17:78846336-78846358 GTGGGGAAACTGAAGGGAGCCGG - Intergenic
1152254138 17:79227604-79227626 GTGGGGAGGCTGACTGGCGGCGG + Intronic
1152302025 17:79500621-79500643 ATGGGGAAATTGAAGGGGGAAGG - Intronic
1152494833 17:80663736-80663758 GAGGGGACTGTGACTGGGGAGGG - Intronic
1153518983 18:5934287-5934309 GAGGGGAACCTGACTGGACAGGG + Intergenic
1153526181 18:5996955-5996977 GTGGGGAGACTAACTCAGGAGGG + Intronic
1155993219 18:32302758-32302780 GGGGGGAAACTGAGAGGTGATGG + Intronic
1156094144 18:33509559-33509581 ATGGGGCCACTGCCTGGGGATGG - Intergenic
1156478602 18:37422105-37422127 GTGAGGAAACTGAATGTGGTGGG + Intronic
1156489319 18:37486950-37486972 CTGTGGAGACTGGCTGGGGATGG - Intronic
1156651784 18:39234288-39234310 ATGGGAAAACTGGCTGGGCATGG - Intergenic
1157017025 18:43727528-43727550 GTTGGGAAGCTGTCTGGAGAAGG + Intergenic
1157165977 18:45358866-45358888 GTGGGGAAAGAGGCTGGGCATGG - Intronic
1157589319 18:48826900-48826922 GTGGGGAAATGGAATGGGGAAGG + Intronic
1159193935 18:65086767-65086789 CTGGGTAAAGTAACTGGGGAAGG + Intergenic
1159269357 18:66129046-66129068 CTGGGGAAATTGGGTGGGGAGGG + Intergenic
1160119111 18:76111549-76111571 GTGGAGAGACTGACTTAGGATGG + Intergenic
1161398240 19:4056069-4056091 CTGGGGAAACAGGCTGGGGGAGG - Intronic
1161598221 19:5163426-5163448 GTGGGGATCCATACTGGGGATGG + Intronic
1161927598 19:7312846-7312868 TTGTGGAAAGTGAGTGGGGATGG - Intergenic
1161963163 19:7533945-7533967 GCGGGGAGACTGGGTGGGGAGGG + Exonic
1162107928 19:8381969-8381991 GTGGGGATCCATACTGGGGATGG - Intronic
1162237459 19:9320473-9320495 GTGGGGATCCATACTGGGGATGG + Intergenic
1162841985 19:13363557-13363579 GAGGGAAAACCCACTGGGGAAGG - Intronic
1164463833 19:28470823-28470845 TTTGGGAAGCTGAGTGGGGAGGG + Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1165847096 19:38825222-38825244 GTGGGGATCCATACTGGGGATGG - Intronic
1165939598 19:39408451-39408473 GAGGGGCAACAGACTGGGGTGGG - Exonic
1166075849 19:40413400-40413422 GGGGGGAAAAGGAATGGGGAGGG + Intergenic
1166200149 19:41232120-41232142 GTGTGGTCACTGTCTGGGGATGG + Intronic
1166338792 19:42124900-42124922 TTGGGGGTACTGACTGGGAAAGG + Intronic
1167174187 19:47853972-47853994 GTGGGGAAACTGATCCTGGAGGG + Intergenic
1167707553 19:51090531-51090553 GTGGGGAGGCTGCCTGAGGAGGG + Intergenic
1168283939 19:55321213-55321235 GTGGGGAAATTGCCTGGAAATGG - Intronic
1168421568 19:56207546-56207568 TTGAGGAAACTGGATGGGGATGG - Intronic
1168426820 19:56245706-56245728 TTGAGGAAACTGAATGGGGAAGG - Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
924988181 2:289075-289097 GGAGGGAAACAGACTGGGGGAGG - Intergenic
927845192 2:26467786-26467808 GTGAGGAAAGTGAGTGGGCAAGG - Intronic
929330381 2:40674654-40674676 GTGGGGATCCATACTGGGGATGG - Intergenic
929440316 2:41961011-41961033 TTGGGCAAAGAGACTGGGGATGG - Intergenic
929694661 2:44104000-44104022 GAGGGGAAAATGAAAGGGGAGGG - Intergenic
930003561 2:46878971-46878993 GTGGGAGAATTGACTGGGGCGGG - Intergenic
930038539 2:47103095-47103117 GTGGGGATCCATACTGGGGATGG - Intronic
931767869 2:65472847-65472869 GGGGGTAAACTGACAGGGGCAGG - Intergenic
932707529 2:74038188-74038210 GTGGGAAATGTGACTGGGGTTGG + Intronic
934943180 2:98517088-98517110 GGGTGGGTACTGACTGGGGAGGG - Intronic
937227781 2:120379514-120379536 GTGGGTAGAAAGACTGGGGAGGG + Intergenic
937257707 2:120566595-120566617 GTGGGGAAACTGAGGTGGGGTGG - Intergenic
937590394 2:123606699-123606721 TTATGGAAACTGAATGGGGAAGG - Intergenic
938653353 2:133406686-133406708 GTTGGGAATCTGTCTGGGGTAGG + Intronic
943103066 2:183510462-183510484 GTGGGGATCCACACTGGGGATGG + Intergenic
943133753 2:183887938-183887960 GTGGGGATCCATACTGGGGATGG - Intergenic
944002609 2:194858724-194858746 GTTGGGAAAGTCAGTGGGGATGG - Intergenic
944755501 2:202757332-202757354 TTGGGGACACGGACTGGGAACGG - Exonic
945698578 2:213141300-213141322 GTGGGGAAAAAGATTGTGGATGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946333483 2:219023084-219023106 GTGGGGGAAGTTACTGTGGATGG + Intronic
947745995 2:232507671-232507693 GGGGAGACACTGGCTGGGGATGG - Intergenic
948082316 2:235216322-235216344 GTGAGGCAGCTGACTGGGCAAGG + Intergenic
948496425 2:238352590-238352612 GTGGGGAAGCTGGGTGGGGGTGG + Intronic
948796061 2:240402580-240402602 TTGGGGAGACTGTCTGGGGTCGG - Intergenic
948804653 2:240448291-240448313 TTGGGGACACTGCCTGGGGCGGG - Intronic
948941872 2:241200866-241200888 GTGCGGACAGTGACTGGGTAGGG - Intronic
948990288 2:241550632-241550654 CTGGGAAAAGTGAATGGGGAGGG + Intergenic
949001208 2:241615175-241615197 GTGGGGAATCTGAACGGTGACGG + Intronic
1170593670 20:17790052-17790074 GTGGGGAGACTGAGAGGGGGAGG - Intergenic
1170888868 20:20363347-20363369 CTGGGGGAACTGGATGGGGAGGG + Intergenic
1171261506 20:23738426-23738448 GTGGGGATCCATACTGGGGATGG - Intergenic
1171270651 20:23814317-23814339 GTGGGGAGCCCTACTGGGGATGG - Intergenic
1171519354 20:25764318-25764340 GTGAGGAAACAGGCTGCGGATGG - Intronic
1171557569 20:26092173-26092195 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1171971977 20:31570251-31570273 GTGGGGAAACAGACAGGAGCGGG + Exonic
1172733595 20:37109242-37109264 ATGGGGATACTGACTGGGCGCGG + Intronic
1173256577 20:41398169-41398191 ATGGGGGAGCTGACTAGGGAGGG - Intergenic
1173559383 20:43991990-43992012 GTGGGGAAACTGAGCAGGTAGGG + Intronic
1175131855 20:56795253-56795275 GAGGGGAAACAGGCTGGGCATGG - Intergenic
1175579822 20:60089652-60089674 GTAGGGCTGCTGACTGGGGAAGG - Intergenic
1175592953 20:60207789-60207811 TTGGTGAAAATGACTGGGGAGGG + Intergenic
1175931499 20:62495912-62495934 GTGAGAAAACAGCCTGGGGAAGG - Intergenic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176653496 21:9570599-9570621 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1178606287 21:34038841-34038863 GTCAGGAAGCTGACTGGTGATGG + Intergenic
1178944708 21:36937166-36937188 CTGGGGACAGTGACAGGGGAGGG - Exonic
1179947420 21:44687629-44687651 TGGGTGAAATTGACTGGGGAAGG + Intronic
1181030321 22:20146301-20146323 GTGGGAAAGCACACTGGGGAGGG + Intronic
1181988354 22:26817653-26817675 GTTGGAAAACAGACTGTGGAAGG + Intergenic
1182335381 22:29580498-29580520 GTGGGGAAACGGACCTGAGAGGG - Intronic
1182737619 22:32542088-32542110 ATGGGGGAACAGACTGTGGAGGG + Intronic
1183324520 22:37184118-37184140 CTGGGGAAGCTGGGTGGGGAGGG + Intronic
1183592734 22:38789966-38789988 CTGGGGAAAAAGACTGGGGTTGG + Intronic
1183678054 22:39310798-39310820 GTGGGGATGCTGACTGGGCAGGG - Intergenic
1183714766 22:39527234-39527256 GTGGGGAAAAGGGCTGGGGTGGG - Intergenic
1185351890 22:50343734-50343756 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185351907 22:50343794-50343816 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185351939 22:50343884-50343906 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185351950 22:50343915-50343937 GGGGGGAAACTGACTGGAGGGGG - Intronic
1185351960 22:50343946-50343968 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185351971 22:50343977-50343999 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185351978 22:50344007-50344029 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185351985 22:50344037-50344059 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185351990 22:50344053-50344075 GAGGGGGCACTGACTGGGGGGGG - Intronic
1185352017 22:50344131-50344153 GGGGGGAAACTGACTAGAGGGGG - Intronic
1185352026 22:50344162-50344184 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352033 22:50344192-50344214 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352040 22:50344222-50344244 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352088 22:50344370-50344392 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352108 22:50344431-50344453 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352155 22:50344566-50344588 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352197 22:50344700-50344722 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352208 22:50344731-50344753 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352215 22:50344761-50344783 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352222 22:50344791-50344813 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352227 22:50344807-50344829 GAGGGGGCACTGACTGGGGGGGG - Intronic
1185352274 22:50344947-50344969 GGGGGGAAACTGACTAGAGGGGG - Intronic
1185352283 22:50344978-50345000 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352290 22:50345008-50345030 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352297 22:50345038-50345060 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352340 22:50345172-50345194 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352351 22:50345204-50345226 CTGGGGGAACTGACTGGAGGGGG - Intronic
1185352360 22:50345233-50345255 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352371 22:50345264-50345286 TGGGGGAAACTGACTGGAGGAGG - Intronic
1185352378 22:50345294-50345316 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352383 22:50345310-50345332 GAGGGGGCACTGACTGGGGGGGG - Intronic
1185352390 22:50345326-50345348 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352437 22:50345478-50345500 GGGGGGAAACTGACTGGAGGGGG - Intronic
1185352474 22:50345599-50345621 GGGGGGAAACTGACTGGAGGGGG - Intronic
1185352484 22:50345630-50345652 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352518 22:50345735-50345757 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352526 22:50345753-50345775 GGGGGGGAACTGACCGGGGGGGG - Intronic
1185352534 22:50345770-50345792 GAGGGGGCACTGACTGGGGGGGG - Intronic
1185352541 22:50345786-50345808 GGGGGGAAACTGACTGGAGGGGG - Intronic
1185352556 22:50345832-50345854 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352591 22:50345956-50345978 GGGGGGGAACTGACTGGAGGGGG - Intronic
1185352626 22:50346080-50346102 CTGGGGGAACTGACTGGAGGGGG - Intronic
1185352645 22:50346143-50346165 CTGGGGGAACTGACTGGAGGGGG - Intronic
949163885 3:913792-913814 GTGGGAAAACAAAGTGGGGAGGG - Intergenic
949319314 3:2791239-2791261 ATGAGGAAACTGACTGGGCATGG + Intronic
949735423 3:7166498-7166520 GTGGAGACAGTGGCTGGGGAAGG - Intronic
950104466 3:10379415-10379437 GTGGGGATACGGGTTGGGGAGGG + Intronic
951706847 3:25552243-25552265 GTGGGCAAACAGGCTGGGCAAGG + Intronic
952940944 3:38443952-38443974 GTGGGGATCCATACTGGGGATGG + Intergenic
953028236 3:39157743-39157765 TTGGGGATATTGACTGGGAAGGG + Intergenic
954586982 3:51744829-51744851 GTGGGGATCCATACTGGGGATGG - Intergenic
954722680 3:52578941-52578963 CTGGAGAAACTGCCAGGGGAAGG + Intronic
955217969 3:57000415-57000437 GAGAGGAATTTGACTGGGGAGGG - Intronic
955408978 3:58643626-58643648 GGGTGGGAACTGTCTGGGGATGG + Intronic
956222541 3:66919769-66919791 GTGGGGTCACTGGGTGGGGAGGG + Intergenic
956842958 3:73157001-73157023 GTGGGGATCCATACTGGGGATGG + Intergenic
957799886 3:85063947-85063969 GTGTGGAAACCTACTGGGGAGGG - Intronic
957913650 3:86656821-86656843 GTGGGGAAACTCAATAGGGTAGG - Intergenic
958575811 3:95949075-95949097 GTGGGGATCCATACTGGGGATGG + Intergenic
958601388 3:96300286-96300308 GTGGGGATCCATACTGGGGATGG - Intergenic
959058061 3:101587980-101588002 ATGGAGAAATTGACTGGGCATGG + Intronic
959582047 3:107992287-107992309 GTGTGGAAACTTAGTGGGCAGGG - Intergenic
960328112 3:116321565-116321587 CTGGGGAAACTGAATTGAGATGG + Intronic
961261664 3:125606866-125606888 GTGGGGATTCATACTGGGGACGG - Intergenic
961424803 3:126836644-126836666 GTGGGGACACTGACCGGGAGAGG + Intronic
961449017 3:126994126-126994148 GTGGGGAAACTGAGTGCTCAAGG + Intronic
962031756 3:131608409-131608431 GTGGGGAAGCTGAGTTGTGAAGG + Intronic
963041236 3:141071547-141071569 ATGAGGAAACTGTCTTGGGAAGG + Intronic
963274846 3:143319726-143319748 GGGGAGAAACTAAGTGGGGAAGG + Intronic
963409219 3:144907361-144907383 GTGGGGATACATACTGGGGACGG + Intergenic
964064501 3:152562321-152562343 GTGGGGATCCATACTGGGGATGG - Intergenic
964484582 3:157174689-157174711 GTGGGGTAAGTGACTGGAGGGGG + Intergenic
964811084 3:160665385-160665407 GAGGGGACACAGTCTGGGGATGG + Intergenic
966748035 3:183296923-183296945 GTTGGGAAACGGATAGGGGAGGG - Intronic
968631375 4:1653894-1653916 GTGGGGACAGTGACTGGAGAAGG - Intronic
969615581 4:8250899-8250921 GTGGGGGAATTGCCAGGGGATGG - Intergenic
969997376 4:11326724-11326746 GTGGAGAAATCGACTGGGCACGG - Intergenic
971161280 4:24136659-24136681 GTGAGGAAACAGGCTGGGAAAGG - Intergenic
971262621 4:25070742-25070764 GTGGGGACACAGAGTAGGGAAGG - Intergenic
971281206 4:25243870-25243892 GTGGGGATCCATACTGGGGATGG + Intronic
971578467 4:28305518-28305540 GTGGGGAACCATACGGGGGATGG - Intergenic
972133307 4:35862688-35862710 GTGGGGATCCATACTGGGGATGG + Intergenic
972598423 4:40550287-40550309 GAGGGGAGACTGACTGCAGAGGG + Intronic
972718797 4:41675434-41675456 GTGGGGAAGTTGACGGGGGATGG - Intronic
973216972 4:47680408-47680430 GTGGGGCACATGAGTGGGGAGGG - Intronic
974187311 4:58460602-58460624 GTGGGGATCCATACTGGGGATGG - Intergenic
975595840 4:76047659-76047681 GTGGGGATCCATACTGGGGATGG + Intronic
976037869 4:80846198-80846220 GTGGGGACACTGTATAGGGATGG + Intronic
976174322 4:82336534-82336556 GTGGGGATCCATACTGGGGATGG + Intergenic
977884091 4:102237809-102237831 GTGGGGATCCATACTGGGGATGG - Intergenic
980290901 4:130846706-130846728 GTGGGGATCCATACTGGGGACGG + Intergenic
981250307 4:142593320-142593342 GTGAGGAAACTTGCAGGGGAGGG - Intronic
981570461 4:146145639-146145661 AATGGGAAACTGACTGGCGAGGG + Intergenic
982309825 4:153973327-153973349 CTGGGGAATCTGACTTAGGACGG - Intergenic
983834936 4:172374662-172374684 GTGGGGATCCATACTGGGGATGG + Intronic
984917444 4:184736945-184736967 GTGGGGATCCATACTGGGGATGG - Intergenic
985477886 5:90152-90174 GTGGGGACACTCAGAGGGGATGG - Intergenic
985537099 5:471612-471634 GTAGGGTCACTGACTGGGCAGGG + Exonic
985612162 5:896021-896043 GTTAGGAAACCGACTGGGCAAGG + Intronic
985612975 5:900420-900442 CAGGGGAGACTGACTGGGGGTGG + Intronic
986317813 5:6602373-6602395 GTGAGGAAAGTGACTTGGGAAGG - Intronic
986933303 5:12853975-12853997 GTGGGGATCCATACTGGGGATGG - Intergenic
987345080 5:16971965-16971987 GTGGGGAAAAAAACTGTGGAAGG - Intergenic
988357795 5:30200115-30200137 GTGGGGATCCATACTGGGGATGG - Intergenic
989496236 5:42113825-42113847 GTGGGGATCCATACTGGGGATGG - Intergenic
989964373 5:50451076-50451098 GTGGGGATCCATACTGGGGATGG + Intergenic
990367877 5:55088666-55088688 GTGGGGATCCATACTGGGGATGG + Intergenic
990571498 5:57083523-57083545 GTTTGGAAACTGGCTGGGCATGG + Intergenic
991143481 5:63273913-63273935 GAGTCCAAACTGACTGGGGATGG - Intergenic
992455191 5:76910009-76910031 GTGGGGATCCATACTGGGGATGG - Intronic
992825657 5:80547586-80547608 CTGGGTAGACTGACAGGGGAAGG + Intergenic
993141100 5:84034589-84034611 GTGGGGAAAAAGACAAGGGAGGG + Intronic
994100303 5:95884084-95884106 GTGGGAGAAGGGACTGGGGAGGG + Intergenic
995838481 5:116421435-116421457 TTGGGGAGGGTGACTGGGGAAGG + Intergenic
996199459 5:120653133-120653155 GAGAGGAAAGTGACTGTGGAAGG + Intronic
997072391 5:130636108-130636130 GTGGGGATCCATACTGGGGATGG - Intergenic
997139646 5:131364924-131364946 TTGAGGAAACGGAGTGGGGATGG + Intronic
998403843 5:141862769-141862791 GTGGGGAGTCTGCCAGGGGAGGG - Intronic
998601822 5:143592583-143592605 GTGGGGAGCCTGACTGGTGGGGG - Intergenic
998915052 5:147003658-147003680 GTGGGGATCCATACTGGGGATGG - Intronic
1000085219 5:157882532-157882554 GTGGGGATCCATACTGGGGATGG - Intergenic
1000255300 5:159532470-159532492 GTGAGGAAATTGAGTGGAGATGG - Intergenic
1001551814 5:172608252-172608274 GAGGGAAGATTGACTGGGGAGGG + Intergenic
1002407457 5:179046978-179047000 GTGAGGAAACTGCCTGAGGCTGG - Intergenic
1003300414 6:4876102-4876124 GGAGGGAAACTGACTGGGAAGGG - Intronic
1003805777 6:9724810-9724832 GTGGGGATCCATACTGGGGATGG - Intronic
1003986234 6:11437878-11437900 ATGGGAAACCTAACTGGGGAAGG + Intergenic
1004072677 6:12315285-12315307 GTGAGGGAACTGACTGGAAAAGG - Intergenic
1004100684 6:12607284-12607306 ATTGGGAAATTGAATGGGGATGG - Intergenic
1004284450 6:14307816-14307838 GTGGGGACAATGACTGGGCGAGG + Intergenic
1005618015 6:27594008-27594030 GTCGGGAAAGAGAGTGGGGAAGG - Intergenic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007030021 6:38618926-38618948 GTGGGGATCCATACTGGGGACGG - Intronic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1007527665 6:42510924-42510946 GGGGGGCAACTGAATGGGTAAGG + Intergenic
1008206093 6:48659151-48659173 GTGCAGAAACTGAGTGGGCAGGG - Intergenic
1008587005 6:52959533-52959555 GTGGGGATCCATACTGGGGATGG + Intergenic
1009470790 6:64027137-64027159 GTGGGGATCCATACTGGGGATGG - Intronic
1011336356 6:86265689-86265711 GAAGTGAAACAGACTGGGGAAGG - Intergenic
1011375060 6:86678873-86678895 GTGGGGATCCATACTGGGGATGG + Intergenic
1012945641 6:105463031-105463053 GTGAGGAAATTGACTGAGAAGGG - Intergenic
1013907862 6:115238634-115238656 GTGGGGATCCATACTGGGGATGG + Intergenic
1013977407 6:116093604-116093626 GTGGGGATCCATACTGGGGATGG - Intergenic
1015036043 6:128655873-128655895 GTGAGGAAACTCTCTGAGGATGG - Intergenic
1015996198 6:138997764-138997786 GAGGGGAAATTTACTGGAGAGGG + Intergenic
1016184014 6:141178676-141178698 GTGGGGATCCATACTGGGGATGG - Intergenic
1016301808 6:142640118-142640140 GAGGGGAATGTGATTGGGGAAGG + Intergenic
1016996621 6:149965768-149965790 GTGGTGAAAGTGAATGGTGAGGG - Intronic
1019353026 7:564088-564110 GTGGGGAGACTGAACAGGGAGGG - Intronic
1019717474 7:2546330-2546352 CTCGGGAAGCTGAATGGGGAGGG + Intronic
1020073170 7:5240685-5240707 GTGGGGCTACAGACAGGGGAGGG - Intergenic
1020658461 7:10954571-10954593 CTGGTGAAACTGTATGGGGATGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021911102 7:25386579-25386601 GAGGGGAGAGTGACTGGGGCAGG + Intergenic
1022595082 7:31705785-31705807 GTGGGGAAGCTGGCTGGAGTGGG + Intronic
1023077975 7:36502249-36502271 GTGGGGATCCATACTGGGGATGG + Intergenic
1025174037 7:56787742-56787764 GCGGGGGAACTGACTGGGTCGGG - Intergenic
1025279835 7:57619258-57619280 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1025304897 7:57846243-57846265 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1025698064 7:63790213-63790235 GCGGGGGAACTGACTGGGTCGGG + Intergenic
1026266159 7:68797738-68797760 ATGGGGAAACTGACTTTGGGAGG - Intergenic
1028495245 7:91453812-91453834 GTGGGGATCCATACTGGGGATGG + Intergenic
1029110398 7:98210948-98210970 GTGGGGAGGCTGTCGGGGGACGG + Intergenic
1029181727 7:98706828-98706850 TTGGGGCTACTGACTGGGAAGGG - Intergenic
1030386542 7:108874135-108874157 GAGAGGAATTTGACTGGGGATGG + Intergenic
1030420496 7:109301710-109301732 GTGGGGATCCATACTGGGGATGG - Intergenic
1031731763 7:125310336-125310358 GTGGGGATCCATACTGGGGATGG - Intergenic
1032638844 7:133742185-133742207 ATGGGGAAAGTGACAGGAGAAGG - Intronic
1032755766 7:134889331-134889353 GTGGGCAGACAGACTGGTGATGG - Intronic
1033226851 7:139569231-139569253 GTGGTGAAATTTCCTGGGGAAGG + Exonic
1033251392 7:139763301-139763323 TATGGGAAACTGGCTGGGGAAGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033759267 7:144422409-144422431 GTGGGGATCCATACTGGGGATGG + Intergenic
1034192389 7:149222330-149222352 GTGGGGCATCTGACTTGGGCAGG - Intronic
1034263890 7:149772484-149772506 GAGGGGAGACGGAGTGGGGAGGG - Intronic
1034579998 7:152033768-152033790 GTGGGGATCCATACTGGGGATGG + Intronic
1035559601 8:594533-594555 GTGGACAAATGGACTGGGGAAGG - Intergenic
1035728523 8:1839478-1839500 GTGTGGAAACTGTCTGGTGTGGG + Intronic
1035728601 8:1839873-1839895 GTGTGGAAACTGTCTGGTGTGGG + Intronic
1036078309 8:5525056-5525078 GTGGGGCCACTGACTGTGGCTGG + Intergenic
1036105552 8:5834193-5834215 CTGGTGAAACTGACAGGGGCAGG - Intergenic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1037769403 8:21789764-21789786 GAGGGGAGACCGGCTGGGGAAGG - Intronic
1037884034 8:22586929-22586951 GTGGGGAGACTCACTTGGGTCGG + Intronic
1038504814 8:28075188-28075210 GGGGGGCTGCTGACTGGGGAAGG + Intronic
1038638770 8:29307493-29307515 GTGGGGATCCATACTGGGGATGG - Intergenic
1038969652 8:32618920-32618942 CTAGGGAAACTGGCTGGGCATGG + Intronic
1040648933 8:49428840-49428862 GTGGGGATCCATACTGGGGACGG - Intergenic
1040965081 8:53074580-53074602 GTGGGGATCCATACTGGGGATGG + Intergenic
1040971483 8:53141065-53141087 GTGGGGATCCATACTGGGGAAGG + Intergenic
1040999961 8:53440347-53440369 GTGGGGATCCATACTGGGGATGG + Intergenic
1041001884 8:53462096-53462118 GTGGGGATCCATACTGGGGATGG - Intergenic
1041625962 8:60027273-60027295 GTGGAGAGACTGACTGTAGAAGG - Intergenic
1042433378 8:68734886-68734908 GTGGGGAAACTAATTGTGAATGG + Intronic
1042871760 8:73406059-73406081 GTGGGGACAGTGAGTGGGAAAGG - Intergenic
1042904269 8:73757281-73757303 GTGGGGAAATGGCCTAGGGAGGG + Intronic
1042919589 8:73908528-73908550 GTGGGGATTCATACTGGGGACGG - Intergenic
1044036323 8:87308012-87308034 ATGGGGAAACTTCCTGGAGAAGG - Intronic
1044748340 8:95393037-95393059 CTGGGGAAGCTCACTGGGGCTGG - Intergenic
1044898466 8:96918614-96918636 GTCTGGGAACTGAATGGGGAAGG + Intronic
1045858529 8:106791072-106791094 GTGGGGATCCATACTGGGGATGG - Intergenic
1049258697 8:141627419-141627441 GTGGGGAACCTGAGTGGTAATGG + Intergenic
1049337737 8:142095562-142095584 CTGAGGAACCTTACTGGGGAGGG + Intergenic
1049353497 8:142176672-142176694 GTGGGGAAAAGGACGGGGGCAGG - Intergenic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1050161645 9:2725913-2725935 GTGAGTAAACTGCCAGGGGAAGG + Intronic
1051507457 9:17842285-17842307 GTGGGAAAACTGACTCAGAAAGG + Intergenic
1051935252 9:22437055-22437077 GTGGGGATCCATACTGGGGACGG - Intergenic
1053277604 9:36795071-36795093 GTGGGGAAATTGAATGTGGTTGG + Intergenic
1053292469 9:36890396-36890418 ATGGGGGAACTGGCTGGGAAAGG + Intronic
1056171356 9:83988124-83988146 TTGGGGAAACTGAGGTGGGAGGG - Intronic
1056392810 9:86154763-86154785 GTGGGGATCCATACTGGGGATGG + Intergenic
1057453080 9:95182885-95182907 CAGGGGAAGGTGACTGGGGAAGG + Intronic
1058578879 9:106433343-106433365 GTGTAGAAAATGACTGGGAAGGG + Intergenic
1058642312 9:107099561-107099583 GTAGGGAAAATAACTGGGGCGGG - Intergenic
1059548081 9:115199216-115199238 GTGGGCAAAGTGACTGGTGATGG + Intronic
1060227971 9:121807731-121807753 GTGGGGCAAGGGACAGGGGACGG + Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1061263763 9:129494122-129494144 ATGGGGAATCTGGCTGGGGCGGG + Intergenic
1061431548 9:130534411-130534433 GTGGGGAGACTGTTGGGGGAGGG - Intergenic
1062207055 9:135343034-135343056 GTGGGGTCTCTGCCTGGGGAGGG + Intergenic
1062519739 9:136952664-136952686 GAGGGGAAACAGGCTCGGGAAGG + Intronic
1203631216 Un_KI270750v1:74046-74068 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1185620276 X:1449828-1449850 GTGGGGATAGTTACTGGTGATGG - Intronic
1186959021 X:14714608-14714630 GTGGGGAAAATGTATGGGCAGGG - Intronic
1187260264 X:17679117-17679139 GTGGGGAAAGTGAGTGGGGGAGG - Intronic
1187829259 X:23364198-23364220 GTGGGGTTATTGACTGGGAAAGG + Intronic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189297919 X:39931854-39931876 GTGGGAAAACTGATTAGAGAGGG + Intergenic
1190541435 X:51482133-51482155 GTGGGGATCCATACTGGGGACGG - Intergenic
1191205961 X:57834499-57834521 GTGGGGATCCATACTGGGGATGG + Intergenic
1192051229 X:67725689-67725711 GTGGGGAATCTGAGTGAGTATGG - Exonic
1192482788 X:71499680-71499702 GTGGGGATCCATACTGGGGACGG + Intronic
1192817826 X:74613464-74613486 ATGGTGAAACTGTCTAGGGAAGG + Intronic
1195439543 X:104885265-104885287 GTGGGGATCCATACTGGGGATGG - Intronic
1196127378 X:112114283-112114305 GTGGGGATCCATACTGGGGACGG + Intergenic
1196661969 X:118279407-118279429 GTGGGGATCCATACTGGGGATGG + Intergenic
1196700847 X:118666404-118666426 GTGGGGAGCCTGACTGGAAATGG - Intronic
1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG + Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1197513379 X:127397525-127397547 GTGGGGATCCATACTGGGGATGG - Intergenic
1198177047 X:134166886-134166908 CTGGGCAAACCGACTGGTGATGG - Intergenic
1198573271 X:137981526-137981548 GTGGGGAAACTGACTGAGAGTGG - Intergenic
1199086743 X:143636220-143636242 GAGGGGAGTTTGACTGGGGAAGG + Intergenic
1200106894 X:153719241-153719263 GTGGGGGTAATAACTGGGGAGGG - Intronic
1200180969 X:154150500-154150522 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200186612 X:154187614-154187636 GAGGGGAGACTGTCTGAGGATGG + Intergenic
1200192264 X:154224752-154224774 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200198019 X:154262556-154262578 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200776197 Y:7172301-7172323 GTGGGGATCCATACTGGGGATGG - Intergenic
1200801050 Y:7387358-7387380 GTGGGGATCCATACTGGGGATGG + Intergenic
1200959286 Y:8982380-8982402 GTGGGGATCCATACTGGGGATGG - Intergenic
1200973269 Y:9179113-9179135 GTTTGGAAACTGATTGGGGAGGG + Intergenic
1201312078 Y:12606206-12606228 GTGGGGATCCATACTGGGGATGG + Intergenic
1201429669 Y:13891463-13891485 GTGGGGATCCATACTGGGGATGG - Intergenic
1201487554 Y:14508833-14508855 GTGGGGATCCATACTGGGGATGG - Intergenic
1201496425 Y:14594886-14594908 GTGGGGATCCGTACTGGGGATGG + Intronic
1201555710 Y:15263236-15263258 GTGGGGATCCATACTGGGGATGG - Intergenic
1201604693 Y:15771965-15771987 GTGGGGAACCATATTGGGGATGG - Intergenic
1201631231 Y:16073769-16073791 GTGGGGATTCATACTGGGGATGG - Intergenic
1202074727 Y:21026597-21026619 GTGGGGATCCATACTGGGGATGG + Intergenic
1202137808 Y:21685400-21685422 GTTTGGAAACTGATTGGGGAAGG - Intergenic
1202242857 Y:22788663-22788685 GTGGGGATCCATACTGGGGATGG - Intergenic
1202272084 Y:23082415-23082437 GTGGGGATCCATACTGGGGATGG + Intergenic
1202293942 Y:23338267-23338289 GTGGGGATCCATACTGGGGATGG - Intergenic
1202395844 Y:24422413-24422435 GTGGGGATCCATACTGGGGATGG - Intergenic
1202425081 Y:24716159-24716181 GTGGGGATCCATACTGGGGATGG + Intergenic
1202445708 Y:24953926-24953948 GTGGGGATCCATACTGGGGATGG - Intergenic
1202474941 Y:25247679-25247701 GTGGGGATCCATACTGGGGATGG + Intergenic