ID: 1196748843

View in Genome Browser
Species Human (GRCh38)
Location X:119096440-119096462
Sequence GAACTCATCTTTTCTTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196748837_1196748843 19 Left 1196748837 X:119096398-119096420 CCTACACCATACTATTTCCCTAG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1196748843 X:119096440-119096462 GAACTCATCTTTTCTTATACAGG 0: 1
1: 0
2: 1
3: 17
4: 243
1196748838_1196748843 13 Left 1196748838 X:119096404-119096426 CCATACTATTTCCCTAGTAGTAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1196748843 X:119096440-119096462 GAACTCATCTTTTCTTATACAGG 0: 1
1: 0
2: 1
3: 17
4: 243
1196748840_1196748843 2 Left 1196748840 X:119096415-119096437 CCCTAGTAGTAGTTTGCAAAGGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1196748843 X:119096440-119096462 GAACTCATCTTTTCTTATACAGG 0: 1
1: 0
2: 1
3: 17
4: 243
1196748841_1196748843 1 Left 1196748841 X:119096416-119096438 CCTAGTAGTAGTTTGCAAAGGTT 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1196748843 X:119096440-119096462 GAACTCATCTTTTCTTATACAGG 0: 1
1: 0
2: 1
3: 17
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196748843 Original CRISPR GAACTCATCTTTTCTTATAC AGG Intronic
900112294 1:1013514-1013536 GAACTCATCTTTGCCAGTACAGG + Exonic
905592774 1:39179106-39179128 GAAGTCATCTTATCTTAGCCAGG + Intronic
907165020 1:52402942-52402964 TAACTTATCCTATCTTATACAGG + Intronic
908121367 1:60989243-60989265 GAACTATTCTTTTTTTAAACAGG - Intronic
908612618 1:65879425-65879447 GAACTTGTCTCTTCTTCTACTGG - Intronic
909174681 1:72341712-72341734 GAATTTATCTTTTCTTTTAAAGG - Intergenic
913499895 1:119462399-119462421 GATCTCATCTTTGCATCTACTGG - Intergenic
914883130 1:151562998-151563020 GAACTTATGTTTTCCTATAATGG + Intronic
916614328 1:166423782-166423804 GAACTCATCCTTTTTTATGGGGG + Intergenic
916893981 1:169142350-169142372 CAACACATCTTATCTTATTCTGG - Intronic
917331367 1:173883648-173883670 GAACTCAGTTTTTTTTATCCAGG + Intronic
918027502 1:180766059-180766081 GAACTTAACTTTTCTTTTCCTGG + Intronic
918350805 1:183653786-183653808 GAACAAATCTTGTCTTAAACTGG - Intronic
918670632 1:187211115-187211137 TATCTCATCTTTTTTTATGCGGG - Intergenic
918868077 1:189929744-189929766 GACCTAATCTTTTATTATGCAGG + Intergenic
924429200 1:243982529-243982551 GAACTCATCTTTTATTGTGTTGG + Intergenic
1063345398 10:5307239-5307261 GAACACATCTTTGTTTACACCGG + Intergenic
1065331765 10:24609155-24609177 GAATACATCTTTAATTATACTGG + Intronic
1066228208 10:33405314-33405336 TAACTTATCTTTTCTCACACAGG + Intergenic
1066492064 10:35903448-35903470 TAACTCATGTTTTCTCATGCTGG - Intergenic
1067287892 10:44920850-44920872 GGACTCAGCTTTTCTGATGCAGG + Intronic
1068278169 10:54830399-54830421 GAACTCATCATTTTTTATGGCGG - Intronic
1069462280 10:68606835-68606857 GAACTCATTTTGTCATAAACTGG + Intronic
1070008908 10:72453439-72453461 TTACTGATCTTGTCTTATACTGG - Intronic
1070069578 10:73074280-73074302 GAACCCATCATTTTATATACTGG + Intronic
1070541851 10:77421166-77421188 GCACTCCTCTTTTCTAATTCAGG + Intronic
1071914757 10:90280881-90280903 GAACTCATCATTTTTTATGGAGG + Intergenic
1074602032 10:114924372-114924394 GAACTCATCTTTTCCTTTCTGGG - Intergenic
1078964280 11:16319668-16319690 GAACTCATCCTTTTTTATGGCGG + Intronic
1078971616 11:16419190-16419212 GAATTCATCATATTTTATACAGG - Intronic
1080175273 11:29355752-29355774 GAACTCATCCTTTTTTATGGCGG + Intergenic
1080175894 11:29362471-29362493 GAACTCATCCTTTTTTATGGCGG + Intergenic
1085019146 11:73194234-73194256 TCACTCATCTCTTCTAATACTGG - Intergenic
1085184715 11:74565875-74565897 GGTCTCTTCTTTTCTTATAAGGG - Intronic
1087213567 11:95469915-95469937 GAACTCATCATTTTTTATGGTGG + Intergenic
1088290381 11:108230701-108230723 GGACTCATTTTTTTTAATACAGG + Intronic
1089928699 11:122286567-122286589 GAACTCATCAGTTGTTGTACAGG - Intergenic
1089997895 11:122926305-122926327 GGACTCATCTCTTCTTAGGCAGG - Intronic
1090756262 11:129794518-129794540 GAACTCATTTTTGATTTTACAGG - Intergenic
1091094458 11:132807058-132807080 TAAGTCTTCTTTTCTAATACAGG - Intronic
1092435601 12:8444697-8444719 GATCTCATCTTCTCTTCTTCTGG - Intergenic
1093350143 12:18089691-18089713 GAACTCATCTGCTCTGAAACTGG - Intronic
1094481771 12:30889004-30889026 GAACTCATCATTTTTTATGGCGG + Intergenic
1096959998 12:55568326-55568348 TAACTCATTTTTTATTTTACAGG + Intergenic
1097556607 12:61146732-61146754 GAACTCATCATTTTTTATGGCGG + Intergenic
1099037767 12:77611106-77611128 AAACTCATCTTTTTTTACATTGG - Intergenic
1099591220 12:84593033-84593055 GAACTCATCATTTTTTATGGCGG - Intergenic
1100625769 12:96330173-96330195 GAACTTATTTTTTCTTGTAATGG - Intronic
1101239753 12:102825905-102825927 GAAGTCATGCTTTCTTATGCTGG + Intergenic
1105245757 13:18648575-18648597 GAGATCATCTTTTCTTATAAGGG - Intergenic
1107434743 13:40372406-40372428 GAACTCATCTTTGAATTTACAGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1108170852 13:47740549-47740571 GAACTCATCCTTTTTTATGGTGG - Intergenic
1108246735 13:48523515-48523537 GAACCCAGCTTTTTGTATACTGG + Intronic
1109432844 13:62258379-62258401 TAAATCATCTTTTGTTTTACTGG - Intergenic
1112867787 13:103927977-103927999 GAACTCATCCTTTTTTATGGCGG + Intergenic
1113159303 13:107361965-107361987 GGATTCATCTTTTCCTAGACAGG - Intronic
1115099039 14:29675794-29675816 GAACTCATCCTTTTTTATGGTGG - Intronic
1115107723 14:29780954-29780976 GAACTCATCCTTTTTTATGGTGG - Intronic
1115333117 14:32219491-32219513 GAACTCATGCTTGCTTATTCTGG - Intergenic
1116107148 14:40523926-40523948 GGATTCATCTTTTCTTCTAGGGG + Intergenic
1116934922 14:50730018-50730040 TATTTCATTTTTTCTTATACTGG + Intronic
1117254758 14:53966479-53966501 CAACTCATTTTTTGTGATACTGG - Intergenic
1118122770 14:62864523-62864545 CAACTCATCTTTTCTTCTTTGGG - Intronic
1120281881 14:82449602-82449624 GAACTTATGTTTTCTGTTACTGG - Intergenic
1120380748 14:83775977-83775999 GAACTCATCATTTTTTATGGCGG - Intergenic
1120960121 14:90116794-90116816 GCGCTCATCTTTTCTCCTACTGG + Intronic
1121992803 14:98576132-98576154 GAACTCTTCGTTTCTTAATCTGG - Intergenic
1122447383 14:101780013-101780035 CAACCCATCTTGTCTTATCCAGG + Intronic
1131715311 15:95103550-95103572 GAACTCATTTTTTTTTACATTGG - Intergenic
1132161510 15:99547336-99547358 GAACTCATATTTTGTTATCTTGG - Intergenic
1132253928 15:100357587-100357609 GAACTCATCCTTTTTTAAAATGG - Intergenic
1137225513 16:46503208-46503230 GAACTCACATTTTCTAATTCAGG + Intergenic
1137895460 16:52206930-52206952 TAACTCATTTTGTCTTATATAGG - Intergenic
1139613764 16:68076705-68076727 GAACTCACCGTTTCATACACAGG - Exonic
1140886265 16:79246479-79246501 GAACTCAAATTTTGTTTTACAGG - Intergenic
1142602430 17:1060528-1060550 GAACTCTTCTTTGCTTATGCTGG - Intronic
1144099587 17:11931962-11931984 GCACACAACTTCTCTTATACGGG - Intronic
1145843939 17:28021433-28021455 GAATTCATCTTTATTTATAATGG + Intergenic
1146126221 17:30233541-30233563 CAACTCATGTTTTCTTAAAGTGG + Intronic
1146406921 17:32546675-32546697 GAACTCATATTTTCATATTTGGG - Intronic
1146660072 17:34659754-34659776 GGACTCATCTTTCCGTATAGGGG - Intergenic
1147494870 17:40906011-40906033 GAACTCATCCTTTTTTATGACGG + Intergenic
1147712616 17:42480637-42480659 GAACTCTTGTTTTTTTATTCTGG + Intronic
1149175647 17:53867417-53867439 TAACTCATTTTTTATTTTACAGG - Intergenic
1149191266 17:54065957-54065979 GAACTCATCTTTAATTAAAATGG - Intergenic
1150546207 17:66159785-66159807 GAGGTCATCTTGTCTTATGCCGG - Intronic
1154443157 18:14411081-14411103 GAGATCATCTTTTCTTATAAGGG + Intergenic
1155442997 18:25881557-25881579 GAACACATTATTTTTTATACAGG + Intergenic
1157456386 18:47833035-47833057 AAACTGATCTTTTTTTATATGGG - Exonic
1158040468 18:53086927-53086949 GAACTCATCATTTTTTATGGGGG + Intronic
1158092111 18:53726977-53726999 TAACTCATTTTTTATTTTACAGG - Intergenic
1158726831 18:59981039-59981061 GAACTCTGCATTTCTTGTACGGG - Intergenic
1159323467 18:66885740-66885762 GAGCTCATATTTTTTTATTCTGG - Intergenic
1160110150 18:76019729-76019751 AAATTCATCTTTTCTAATACAGG - Intergenic
1165578679 19:36843577-36843599 GAATTCATCCTTTCCTTTACTGG - Intronic
1166172378 19:41038817-41038839 GAACTCATCCTTTTTTATTATGG - Intergenic
925016940 2:535531-535553 AAACCCATCTGTTCTCATACGGG - Intergenic
925682759 2:6440204-6440226 GAAATCATCTCTTTTTATACAGG - Intergenic
931009659 2:57895497-57895519 GAACTGCTCTTTTCTAACACAGG - Intergenic
931546432 2:63393200-63393222 GAACTCATCCTTTTTTATGGCGG - Intronic
933533775 2:83545541-83545563 GAACTTATATGTTCTTAGACAGG + Intergenic
934946962 2:98549310-98549332 GAACTCCTGTCTTCTTATACAGG + Intronic
936878070 2:117216273-117216295 TAACTCATCTATTCTTTTTCTGG + Intergenic
937068040 2:119034064-119034086 GAACTCATCATTTTTTATGGTGG - Intergenic
937346840 2:121131403-121131425 GAACTCTTTTTTTCTGAGACAGG - Intergenic
937475223 2:122209126-122209148 GCACTCACCTTTTCTTTTCCTGG + Intergenic
937689573 2:124739819-124739841 GAAGTCATATTTTCTTACTCTGG + Intronic
937723339 2:125129019-125129041 GGATTCCTCTTTTCCTATACGGG - Intergenic
939101070 2:137895451-137895473 GAGATCATCTTTTCTTATAAGGG - Intergenic
940000326 2:148961098-148961120 GATCGCATCATCTCTTATACTGG + Intronic
940114009 2:150187696-150187718 GAAATCATATTTTCATATAAAGG - Intergenic
940466104 2:154029223-154029245 GAAAGCATCTCTTCTGATACAGG + Intronic
942874838 2:180782736-180782758 GAACTCATCCTTTTTTATGGTGG + Intergenic
943131200 2:183855204-183855226 GAACTCATCATTTTTTATGGCGG - Intergenic
944109698 2:196119112-196119134 GAACACATCAGTTCTTGTACTGG - Intergenic
1171448985 20:25223136-25223158 GAACTGATCTTTTCCTACTCAGG - Intronic
1176452936 21:6880118-6880140 GAGATCATCTTTTCTTATAAGGG - Intergenic
1176831109 21:13745166-13745188 GAGATCATCTTTTCTTATAAGGG - Intergenic
1177416979 21:20806726-20806748 TAACTCATCTTTTCTTATTCAGG - Intergenic
1177462765 21:21434666-21434688 GAACTTTTTTTTTCTAATACTGG - Intronic
1177571665 21:22894926-22894948 GAACTCATCCTTTTTTATGGCGG + Intergenic
1178609533 21:34068829-34068851 GAACTCACCTTTTAGAATACAGG + Intergenic
1179237090 21:39557219-39557241 GAACTCATCATTTTTTATGGCGG + Intronic
1182783701 22:32888914-32888936 GAACTCATCATCCCTTAAACTGG - Intronic
1183875632 22:40778014-40778036 GATCTTATCTTTTCTTGTGCTGG - Intronic
1185261434 22:49867011-49867033 GAGGTCATCTTTTCTAACACAGG + Intronic
1185279500 22:49964022-49964044 GAGATCATATTTTTTTATACAGG + Exonic
949732321 3:7128036-7128058 GAACTCTTCTAGTCTTTTACTGG - Intronic
950302445 3:11892574-11892596 GAACTCATCATTTTTTATGGTGG + Intergenic
950815710 3:15700050-15700072 GAACTCATCCTTTTTTATGGTGG - Intronic
951341620 3:21494926-21494948 GAAATAATCTTTTCCTATAAAGG - Intronic
952699055 3:36306084-36306106 GAGCTCATCTTTTTCTATTCGGG + Intergenic
954970027 3:54643832-54643854 CTACTCATGTTTACTTATACTGG - Intronic
955893572 3:63675519-63675541 GAAATCATCTCTTCTTATAAAGG - Intronic
958568713 3:95851545-95851567 GAAATCATATTTTGTTATACTGG - Intergenic
959312953 3:104763853-104763875 GAATTCCTCTTTTCTTTTAAAGG - Intergenic
961852075 3:129830516-129830538 CAACTCATCTCTTCTTGCACTGG + Intronic
962689876 3:137884314-137884336 GAACTCATCCTTTTTTATGACGG + Intergenic
963386539 3:144602183-144602205 GAACTCATGTTTTTTTATCTTGG - Intergenic
964015198 3:151936656-151936678 GAAGTCTTTTTTTCTTATCCTGG + Intergenic
965911757 3:173786695-173786717 AAATTCATTTTTTCTGATACAGG - Intronic
966291961 3:178369842-178369864 GAACTAATCACTTCTTATTCGGG + Intergenic
967617829 3:191594161-191594183 GAATTCAACTTTTCTGTTACAGG + Intergenic
968028156 3:195460501-195460523 GAGCTTATCTTTTCTTGTAAGGG - Intergenic
973730941 4:53821763-53821785 GAGCCCATCCTTTCTTATTCGGG - Intronic
974223594 4:59009162-59009184 GAACTCATCATTTTTTATTGTGG + Intergenic
974792160 4:66706022-66706044 GAAATCATGTTTGATTATACTGG + Intergenic
974809255 4:66924400-66924422 TAAATCATTTTTTCTTAAACAGG + Intergenic
975310044 4:72893696-72893718 GAACTGATCTTTTCTTTCATAGG - Intergenic
977765193 4:100789154-100789176 GAAAACATATTTTCTTATATGGG + Intronic
978098031 4:104803447-104803469 GAACTCATCATTTTTTATGGCGG + Intergenic
978454705 4:108875877-108875899 GAACTCATCCTTTTTTATGGCGG - Intronic
978551640 4:109933748-109933770 GAACTCATCCTTTTTTATGGCGG + Intronic
979403810 4:120283900-120283922 AAAATCATATTTTCTAATACTGG + Intergenic
980223833 4:129955355-129955377 GAATTCATATTTTCTTATTATGG + Intergenic
981133402 4:141183833-141183855 GAACTCATTCATTTTTATACCGG + Intronic
981143148 4:141293584-141293606 GAAATCATCTTTTCTTTAACTGG - Intergenic
983280256 4:165671850-165671872 GAACTCATCTTTTGATTTTCAGG + Intergenic
983293292 4:165833607-165833629 TAACTCATCATTTCTTTTACAGG + Intergenic
987377829 5:17253041-17253063 GAATTCGTCTTTTCTTCTAGAGG - Intronic
988075222 5:26343683-26343705 GTAATAATTTTTTCTTATACAGG - Intergenic
988352251 5:30124310-30124332 GAATACATATTTTTTTATACCGG + Intergenic
988369803 5:30353760-30353782 GAAATCACCTTTTCTTTTCCAGG + Intergenic
989366522 5:40662297-40662319 GAACTCATCCTTTTTTATGGGGG - Intergenic
990059814 5:51633543-51633565 AAACTCATATTTTCTTATTTTGG + Intergenic
990647421 5:57859884-57859906 GATTTTATCTTTTCTTTTACTGG + Intergenic
990647946 5:57865687-57865709 GAACTCATCCTTTTTTATGGCGG + Intergenic
990710851 5:58578595-58578617 GAACTCATCATTTTTTATGGCGG - Intergenic
990980321 5:61596872-61596894 AAACTCAGGTTTTCTCATACAGG + Intergenic
991054792 5:62308151-62308173 TAATTTATCTTTTCATATACAGG - Intronic
991635145 5:68697316-68697338 GAACTCATCCTTTTTTATGGCGG - Intergenic
991641073 5:68753234-68753256 GAATGCATCTTTCCATATACAGG - Intergenic
993528266 5:88993441-88993463 GAACTCATCCTTTTTTATGGTGG - Intergenic
994651428 5:102534204-102534226 GAACTCATCGTTTTTTATGGCGG - Intergenic
994846867 5:105000888-105000910 GAACTCATCATTTTTTATGGCGG + Intergenic
995490136 5:112682547-112682569 TAAGTCATCTTTTCTCATTCTGG + Intergenic
995580175 5:113591019-113591041 GAACTTATGTTTTCTTTTATAGG + Exonic
995786671 5:115838236-115838258 CATCTCATATTTTCTTACACTGG - Intronic
995852063 5:116556668-116556690 GAAGTCAGCTTTTCTTCTAGAGG - Intronic
998698726 5:144672502-144672524 TAACTCTGCATTTCTTATACGGG + Intergenic
999659076 5:153839972-153839994 CAAAACATCATTTCTTATACAGG + Intergenic
1000535829 5:162477195-162477217 GAACTCATCGTTTTTTATGGCGG + Intergenic
1002981382 6:2142040-2142062 GCACTTGTATTTTCTTATACGGG + Intronic
1003689552 6:8339254-8339276 GGACTCATCTTTTCTCAATCAGG + Intergenic
1005190588 6:23217421-23217443 TAACTCATTTTTTCTAGTACTGG + Intergenic
1007239750 6:40416496-40416518 GAACTGACCTTTTCTTACACTGG + Intronic
1008132814 6:47738064-47738086 GAAGTCATCTTTTATTATCTGGG - Intergenic
1010241212 6:73617388-73617410 GAAACCATTTATTCTTATACAGG - Intronic
1010341456 6:74758197-74758219 AAACTTCTCTTTTCTTACACTGG - Intergenic
1010896298 6:81368596-81368618 GAATTTATCTTTTCTTTCACTGG - Intergenic
1011006464 6:82651147-82651169 GAACTCATCCTTTTTTGTAGTGG - Intergenic
1013020212 6:106207249-106207271 GCAATCATTTTTTCTTATATGGG + Intronic
1013734746 6:113212697-113212719 GAACTCATCCTTTTTTATGGCGG + Intergenic
1013890710 6:115023256-115023278 GAATTCATTTTTTCTTAAATAGG + Intergenic
1014301536 6:119688299-119688321 CCATTTATCTTTTCTTATACTGG - Intergenic
1014567228 6:122964468-122964490 CAAGTCATTTTTTTTTATACAGG - Intergenic
1014580390 6:123129682-123129704 GAACTCATCATTTTTTATGGCGG - Intergenic
1014598449 6:123375922-123375944 GATCTCATTTTTTTATATACAGG + Intronic
1014834288 6:126143001-126143023 GAACTAATATTTTCTTTTAAAGG - Intergenic
1015103195 6:129505464-129505486 GAAGTCATCTTTTCTGATAAGGG + Intronic
1015330476 6:131973053-131973075 GAACCCATCTTTCCTTTTATAGG + Intergenic
1016020212 6:139229236-139229258 GCCCTCATCCTTTCTAATACTGG + Intergenic
1017323184 6:153116739-153116761 GAACTCATCCTTTTTTATGGTGG - Intronic
1021031335 7:15740122-15740144 GCATCCATCTTTTCTTATATGGG - Intergenic
1021611553 7:22462557-22462579 GAACTCATCATTTTTTATGGTGG + Intronic
1021619164 7:22533980-22534002 GAACTCATCATTTTTTATGGTGG - Intronic
1022067832 7:26878435-26878457 ATACTCATCTTTTCATGTACTGG - Intronic
1022578982 7:31528781-31528803 CAATTCATCTTTTCTCATATTGG + Intronic
1023421373 7:39983633-39983655 GAAATCAACTTTTCCTACACTGG - Intronic
1024750352 7:52458102-52458124 GAATTAATCTTTTCTTAGAGTGG + Intergenic
1024822666 7:53351584-53351606 GATCTCATGTTTTCTTTTTCTGG + Intergenic
1025168943 7:56738645-56738667 GAACTCATTTTGTCATAAACTGG - Intergenic
1025473153 7:60884339-60884361 GAACTCACCTTTTCATAGAGCGG - Intergenic
1025490355 7:61111312-61111334 GAACTCACCTTTTCATAGAGCGG + Intergenic
1025513852 7:61605527-61605549 GAACTCACCTTTTCATAGAGCGG + Intergenic
1025538196 7:62034367-62034389 GAACTCACCTTTTCATAGAGCGG + Intergenic
1025703445 7:63841249-63841271 GAACTCATTTTGTCATAAACTGG + Intergenic
1027452930 7:78353499-78353521 TAACTCATCTTAACTTATGCAGG - Intronic
1027815579 7:82966102-82966124 GAACGTATCTTTTCTTCTTCAGG + Exonic
1028519813 7:91717340-91717362 GAACTCATCATTTTTTTTATTGG + Intronic
1030725911 7:112923858-112923880 GAACTCATCATTTTTTATGGCGG - Intronic
1032974816 7:137210151-137210173 GAACTCATCATTTTTTATGGCGG + Intergenic
1038406065 8:27323933-27323955 AAACTCTCCTTTTCTTAAACAGG + Intronic
1038711289 8:29949017-29949039 GAACTTTTCTTTTCTTGTAAGGG - Intergenic
1040620942 8:49091906-49091928 TAACTTATCTTTTGTTATAGGGG + Intergenic
1041277827 8:56181382-56181404 GAACTCATCCTTTTTTATGGCGG - Intronic
1042253309 8:66777794-66777816 GAACTCATCTCTTCATCTATAGG - Intronic
1042418206 8:68551818-68551840 AAACTCATGTTTTCTTCTAAAGG + Intronic
1042435076 8:68754806-68754828 TACCTCAGCTTTTCATATACAGG - Intronic
1043219141 8:77636857-77636879 GAACTCATCCTTTTTTATGGCGG - Intergenic
1045356392 8:101392870-101392892 GAACTGATATTTTCTTAATCTGG - Intergenic
1045392521 8:101729708-101729730 GAAATCATCTTGTCTTCTCCAGG + Intronic
1046493716 8:114986402-114986424 GATCTCATCTTCTCTTCCACTGG - Intergenic
1046910327 8:119619130-119619152 GAACTGAAATTCTCTTATACAGG - Intronic
1046963278 8:120132764-120132786 AAACTGATTTTTTATTATACAGG + Intronic
1048758724 8:137767672-137767694 TAACTCATTTTTTATTTTACAGG + Intergenic
1050742485 9:8837895-8837917 GTAGTCAACTTTTATTATACTGG - Intronic
1050984535 9:12065401-12065423 GAAAACATTATTTCTTATACTGG - Intergenic
1051220814 9:14846577-14846599 TCACTCATCTTTTCTTAAGCAGG - Intronic
1051326067 9:15970075-15970097 GAAATCATCTCTTTTTATACTGG - Intronic
1052049404 9:23827847-23827869 GAACTCGTATATTGTTATACAGG - Intergenic
1052542511 9:29828649-29828671 TAACTCATTTTTTATTTTACAGG + Intergenic
1055863643 9:80786127-80786149 GAACTCATCCTTTTTTATGGTGG - Intergenic
1056674994 9:88667989-88668011 GAACTCATCATTTTTTATGGCGG + Intergenic
1057147170 9:92765808-92765830 GAACTCATCTGCACTGATACTGG - Intergenic
1058249516 9:102673998-102674020 GTTCTAATTTTTTCTTATACTGG - Intergenic
1059544733 9:115164854-115164876 GAAGTCATCATTTCGGATACAGG - Intronic
1059962720 9:119581900-119581922 GAACTCATCCTTTTTTATGGCGG + Intergenic
1061969820 9:134038903-134038925 GAAATCCATTTTTCTTATACAGG - Intronic
1062298294 9:135847520-135847542 GAACTCATCCTTTTTTTTAATGG - Intronic
1203516245 Un_GL000213v1:4397-4419 GAGATCATCTTTTCTTATAAGGG + Intergenic
1185840485 X:3384853-3384875 AAATTCATCTTCTCATATACTGG + Intergenic
1187297709 X:18018170-18018192 CAACACATCTTATCTTAGACTGG - Intergenic
1191745862 X:64485868-64485890 GAACTCATCCTTTTTTATGGAGG - Intergenic
1194409493 X:93540272-93540294 GAATTCTTTTTTTCTTATGCAGG - Intergenic
1196528297 X:116752536-116752558 GAACTCATACATTCTTTTACGGG - Intergenic
1196561867 X:117159451-117159473 GAACTCATCCTTTTTTATGGTGG - Intergenic
1196748843 X:119096440-119096462 GAACTCATCTTTTCTTATACAGG + Intronic
1197154959 X:123260182-123260204 GAACTCATCTATTCTTCTCTGGG + Intronic
1198072810 X:133166254-133166276 GAACTCATCCTTTTTTATGGCGG - Intergenic
1200723786 Y:6639399-6639421 GAACTCATCCTTTTTTTTATTGG + Intergenic