ID: 1196750096

View in Genome Browser
Species Human (GRCh38)
Location X:119108252-119108274
Sequence ATTCCTACTCTGCTACTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196750096 Original CRISPR ATTCCTACTCTGCTACTTAC TGG (reversed) Intronic
900593038 1:3468280-3468302 ATTCGTGCTCTGCTCCTCACTGG - Intronic
900953140 1:5870424-5870446 ATTCCTTCTCTGTTGATTACTGG - Intronic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
902960900 1:19962186-19962208 GTTCCTTCTCTGCTGCTTTCTGG - Intergenic
903032079 1:20471164-20471186 ATCCCAACTCTGCCACTTACTGG - Intergenic
903191907 1:21661534-21661556 ATTCCTGCTCTGCCACTTCCTGG + Intronic
903573695 1:24324754-24324776 GGTCCAGCTCTGCTACTTACTGG - Intronic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
904205025 1:28848751-28848773 ATACCAGCTCTGCCACTTACTGG + Intronic
904262945 1:29300888-29300910 ATTCCTACTCAGCAACTAACTGG - Intronic
904416871 1:30367615-30367637 ATACCAACTCTGCCACTTCCTGG - Intergenic
905231585 1:36517777-36517799 GTACCCACTCTGCCACTTACTGG - Intergenic
906898814 1:49810187-49810209 ATTCTGTCTCTGCTACTTACTGG - Intronic
907091008 1:51725644-51725666 AGCCCTACTCTCCCACTTACAGG - Intronic
907820303 1:57960978-57961000 ATTCCAGCTCAGCTACTTACTGG + Intronic
908061418 1:60354103-60354125 TTTCCTACTCTGCCACCAACAGG + Intergenic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
908556754 1:65264247-65264269 ATTCCTAGTCTGCCACTCAATGG + Intronic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
909193218 1:72581415-72581437 ATTCCTCCTCTGTTTCTTAGTGG - Intergenic
909722619 1:78794062-78794084 TCTCATACTCTGCTTCTTACTGG - Intergenic
910114416 1:83716531-83716553 TGTCCAACTCTGCTGCTTACCGG - Intergenic
910700965 1:90073586-90073608 TTTCCCACTCTGCCACTTATGGG - Intergenic
910719176 1:90266647-90266669 ATCCTGACTCTGCTATTTACTGG + Intergenic
910834357 1:91493437-91493459 ATTTCAGCTCTGCCACTTACTGG + Intergenic
912137411 1:106678863-106678885 ATGCCTACTCTATTACTTACTGG + Intergenic
912248339 1:107984584-107984606 ATGCCTGTACTGCTACTTACTGG - Intergenic
912299378 1:108498435-108498457 ATCCCGGCTCTGCCACTTACTGG - Intergenic
912994460 1:114519042-114519064 ATTCCAGCTCTGTTACCTACTGG + Intergenic
913109553 1:115645197-115645219 ATTTCTATTCTGTTTCTTACAGG - Intronic
913158470 1:116123575-116123597 ATTCTGACTCTTCTACTTACTGG + Intronic
915278410 1:154805705-154805727 ATTCCAACCTTGCCACTTACCGG + Intronic
915842121 1:159222339-159222361 ATCCCAACTCTGCTACTTATTGG + Intergenic
917731512 1:177879520-177879542 ATCCCAACTCTGGTACTTGCTGG + Intergenic
918102718 1:181390533-181390555 ATTTACACTCTCCTACTTACGGG - Intergenic
919395354 1:197040033-197040055 ATATATCCTCTGCTACTTACAGG - Intronic
919877917 1:201884065-201884087 AGTCCTGCTCTGCCACTTACTGG - Exonic
919930208 1:202216349-202216371 TTTCCAGCTCTGCCACTTACTGG - Intronic
920658219 1:207892177-207892199 ATCCTTACTCTGCTCTTTACTGG + Intronic
922852783 1:228747937-228747959 ATTCTGGCTCTGCCACTTACTGG + Intergenic
922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG + Intergenic
924003646 1:239582540-239582562 ATCCCTCCTCTGCTCCATACAGG + Intronic
1064780691 10:18835119-18835141 ATTCCCTCTTTGCTACTTTCTGG + Intergenic
1067255735 10:44638046-44638068 ATTCCTCCTCTGCAATTTTCTGG - Intergenic
1068419097 10:56765865-56765887 ACTCCTACTCTGCTTCATATTGG + Intergenic
1068814357 10:61293055-61293077 ATTGCAATTCTGCTACTTCCTGG + Intergenic
1068842510 10:61631185-61631207 ATCCTTCCTCTGCCACTTACTGG + Intergenic
1068912202 10:62390133-62390155 ATTCTTACTCTGCTTCTGACTGG + Intronic
1069431178 10:68335817-68335839 ATCCCTACTCTGCCACTCACTGG - Intronic
1069549341 10:69351717-69351739 ATGCTGACTCTGCCACTTACTGG + Intronic
1070319822 10:75346208-75346230 GTTCCTGCTCTGCTACTTACTGG + Intergenic
1070750796 10:78962923-78962945 ATCCCAGCTCTGCTACCTACTGG + Intergenic
1071126256 10:82338819-82338841 ATTACTACTTTACTACTTGCTGG - Intronic
1071197684 10:83179973-83179995 CTTCCTTCTCTGCCTCTTACAGG + Intergenic
1071669841 10:87598129-87598151 ATTCCTAGTCTTCCACTTCCTGG - Intergenic
1072813349 10:98481000-98481022 ATCCCTGCTCTGTTACTTGCTGG - Intronic
1073140534 10:101244302-101244324 ATCCTTACTCTGCCACTTCCTGG - Intergenic
1073461524 10:103668330-103668352 ATTCCAGCTCTGCTACGTCCTGG - Intronic
1074086606 10:110212624-110212646 CTTGCTACTCTACTGCTTACTGG + Intronic
1074161938 10:110842755-110842777 ATCCCAACTCTGCCACTTACTGG - Intergenic
1074207073 10:111292122-111292144 ATTCTGACTCTGTTATTTACTGG - Intergenic
1074752184 10:116597403-116597425 ATTCCTACTCAGCTGCTTTTGGG - Intronic
1075518224 10:123126680-123126702 ATTCCAACTCTGCCACTTACAGG - Intergenic
1077674207 11:4182858-4182880 ATCCCAGCTCTGCTACTTCCTGG - Intergenic
1078513714 11:12006420-12006442 GTCCCTGCTCTGCCACTTACTGG - Intronic
1078963371 11:16306410-16306432 ATACCTAATCTTCTACTGACTGG - Intronic
1079678991 11:23268788-23268810 AATCCTGCTGTGCCACTTACTGG - Intergenic
1080325724 11:31070568-31070590 ATTCCAGCTATGCTATTTACTGG + Intronic
1080866590 11:36200656-36200678 ATGCCTGCTCTGCCACTTGCTGG + Intronic
1080873117 11:36254108-36254130 AGACCAACTCAGCTACTTACTGG + Intergenic
1081581956 11:44358700-44358722 ATTCCAGCTCTACCACTTACCGG - Intergenic
1082195997 11:49306529-49306551 ATGCTTCCTCTGCCACTTACTGG - Intergenic
1086659832 11:89401704-89401726 ATGCTTCCTCTGCCACTTACTGG + Intronic
1088687764 11:112298939-112298961 AGTCCTGCTGTGCTACTTCCTGG + Intergenic
1089238928 11:117057714-117057736 ATTCCAACTCTGCTACCAAATGG + Intronic
1090478888 11:127050176-127050198 ATCCTGACTCTACTACTTACTGG - Intergenic
1090657177 11:128855001-128855023 ATTCCAGCTCTGCAGCTTACTGG + Intronic
1090917938 11:131182813-131182835 ATCCCAGCTCTGCTACTTACTGG + Intergenic
1090976425 11:131684025-131684047 ATTCTAACTCTACTACTTACTGG + Intronic
1091107097 11:132932928-132932950 ATCCCAACTCTGGTACTTAATGG - Intronic
1091825001 12:3505685-3505707 ATTCCAGCTCTGCTACTTACTGG - Intronic
1091992701 12:4969125-4969147 TTTCTTAGCCTGCTACTTACAGG - Intergenic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1094332365 12:29308345-29308367 ATTCCAGCTCCACTACTTACTGG + Intronic
1096585127 12:52614975-52614997 CTTCCAACTCTGCTAGTTTCTGG - Intronic
1096926267 12:55151298-55151320 ATTCATGCTCTGCCACTCACTGG - Intergenic
1097419916 12:59364136-59364158 ATTCTCACGCTGTTACTTACTGG + Intergenic
1097578499 12:61424626-61424648 ATTTAGGCTCTGCTACTTACTGG - Intergenic
1098029225 12:66237072-66237094 ATCCCTACTCCTCTACTTTCTGG + Intronic
1100008552 12:89924203-89924225 ATTCCCACTTTGCCACTTTCTGG + Intergenic
1101372148 12:104139328-104139350 ATTCCAACTCCCCTTCTTACAGG + Intergenic
1102804083 12:115764018-115764040 ATTCCAACTTTTCTCCTTACTGG - Intergenic
1105412766 13:20185050-20185072 GTTCCTACTGTGCTTGTTACCGG + Intergenic
1105556906 13:21455960-21455982 ATTCTTACCATGCTACTTACTGG + Intronic
1105778857 13:23689098-23689120 ATTACAGCTCTGCCACTTACTGG - Intergenic
1107039226 13:35931944-35931966 ATTCCAACTCTGTTACCCACTGG + Intronic
1107602026 13:42023275-42023297 ATTCCAACCCTGCCATTTACTGG + Intergenic
1108143859 13:47455933-47455955 ATTCCTAGTCTGCAACTTAGTGG + Intergenic
1108283494 13:48882822-48882844 ATTCCTACTCTGGTCCTTTCTGG - Intergenic
1108841532 13:54622747-54622769 ATTCTTACTCTGCGATTTAAAGG - Intergenic
1109470313 13:62795490-62795512 ATTTTTGCTTTGCTACTTACTGG - Intergenic
1110940975 13:81347886-81347908 ATTCCAATTTTGCCACTTACTGG + Intergenic
1111721472 13:91950874-91950896 ATTCTCTCTCTGCTATTTACTGG - Intronic
1111833486 13:93358520-93358542 ATTCCCACTCTGCTACTTAAGGG - Intronic
1113020077 13:105875275-105875297 ATTCATACCTTGCTACTTACTGG + Intergenic
1113561808 13:111287290-111287312 ATGCCTGCTCTGTTGCTTACTGG + Intronic
1114444684 14:22779405-22779427 ATTTCAACTCCTCTACTTACCGG + Intronic
1114461570 14:22889393-22889415 ATCCCAACTCTACTGCTTACCGG - Intergenic
1114532562 14:23404855-23404877 ATTCCTACTGTTCTCCATACAGG + Intronic
1116929706 14:50677859-50677881 CTTCCTTCTCTACTACTTGCAGG - Intergenic
1117697764 14:58383324-58383346 ATTCCTACTCTCCTATTTTTTGG + Intergenic
1117720106 14:58620635-58620657 ATTTCTACTTTTCTACCTACAGG + Intergenic
1118335606 14:64851258-64851280 ATTCCAGCTCTGCCACTTACTGG + Intronic
1118416444 14:65541967-65541989 ATTCTGGTTCTGCTACTTACTGG + Intronic
1118475376 14:66111517-66111539 AATCCTTCTCTGGGACTTACTGG - Intergenic
1119277829 14:73375406-73375428 ATTCCAGCTCTGCTACTTAGAGG - Intronic
1119821219 14:77617404-77617426 ATTCCAACTCTGCCAATAACTGG + Intergenic
1119980365 14:79073852-79073874 ATTGCAGCTCTGCTACTTACTGG + Intronic
1120815548 14:88853604-88853626 ATTCTTGTTCTGCCACTTACTGG - Intronic
1121941748 14:98077348-98077370 ATTCCTTCTCTGCTGCCCACAGG + Intergenic
1122416638 14:101552924-101552946 ATTCCGACTCTGCTTCCTAGAGG - Intergenic
1122465593 14:101931447-101931469 ATTCCTATTTTCCTACTTACAGG + Intergenic
1122798732 14:104219429-104219451 ATTCCAGCTTTGCTGCTTACGGG - Intergenic
1125118564 15:36124832-36124854 ATCCCAACTTTGCCACTTACTGG - Intergenic
1125979309 15:43985333-43985355 GTTCCTACTCTGCTTGTAACTGG + Intronic
1125988763 15:44084084-44084106 GTTCCAACTCTGCCACTGACTGG + Intronic
1127568798 15:60220274-60220296 ATTCCAATTCTGCCACTTACTGG - Intergenic
1127696795 15:61457692-61457714 ATTCTGATTCTGCCACTTACTGG - Intergenic
1127705370 15:61541673-61541695 CTTCCTACTCTGCCACTTTATGG - Intergenic
1127747223 15:61990877-61990899 AATTCCACTCTGCTACTTAATGG - Intronic
1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG + Intergenic
1128463294 15:67887763-67887785 ATTCCAACCCTGCTACTCCCAGG - Intergenic
1128559095 15:68652809-68652831 ATTCTGACTCTGCTACTTGTGGG - Intronic
1129667147 15:77585589-77585611 ATCCTCACTCTGCTACTTACTGG + Intergenic
1129765273 15:78161221-78161243 ATCTCATCTCTGCTACTTACTGG + Intronic
1130213883 15:81950651-81950673 ATTCTGACTCTACCACTTACTGG - Intergenic
1130745690 15:86651498-86651520 ATTCCAGCACTGCTACTTATTGG + Intronic
1133245106 16:4443419-4443441 GTGCCTACTCTGCTTCTTCCTGG + Intronic
1134080142 16:11319359-11319381 ATTCTTGCTCTGCCACTTAATGG + Intronic
1134617837 16:15665355-15665377 ATTCCAGCTCTGCTACTTATTGG - Intronic
1134746603 16:16593613-16593635 AGTCCTACCCTGCCACCTACAGG - Intergenic
1134998871 16:18760067-18760089 AGTCCTACCCTGCCACCTACAGG + Intergenic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135210362 16:20520859-20520881 ATTCCAGTTCTGCCACTTACTGG + Intergenic
1135397201 16:22140214-22140236 ATGCCAACTCTGCTACTGAGTGG - Exonic
1135524629 16:23205146-23205168 ATTCCCACTGTGCTACCTAGTGG - Intronic
1135797880 16:25463043-25463065 CTCCCAACTCTGCTACTTACTGG - Intergenic
1138190234 16:55008757-55008779 ATCCCAACTCTGCCACTTATGGG - Intergenic
1138322305 16:56126100-56126122 AATCCAACTCTGCTATTTCCTGG - Intergenic
1139098284 16:63732783-63732805 ATACCTACTGTGCTATTTAAAGG - Intergenic
1139702245 16:68715117-68715139 ATTCCCTTTCTGCTACTTCCTGG - Intronic
1140137659 16:72222089-72222111 ACCCCAACTCTGCCACTTACTGG - Intergenic
1140260994 16:73379447-73379469 GTTCCACCTCTGCTACTTACAGG + Intergenic
1140813296 16:78598976-78598998 ATGCCGACCCTGCCACTTACTGG - Intronic
1141760316 16:86024869-86024891 ATCCCCACTCTGCCACTTACTGG - Intergenic
1147385372 17:40078034-40078056 ACTCCTCCTCTGCCACTCACAGG + Intronic
1148960637 17:51389755-51389777 ATTCCATCTCTGCTATTAACTGG - Intergenic
1149368016 17:55965003-55965025 ATCCCGAGTCTGCTACTTCCTGG - Intergenic
1150044474 17:61899159-61899181 ATCCCATCTCTGCTAATTACTGG + Intronic
1151201343 17:72470039-72470061 AGTCCCACCCAGCTACTTACTGG + Intergenic
1153675673 18:7454170-7454192 ATTCATACTCTTCTCCCTACAGG + Intergenic
1155203905 18:23540724-23540746 ATCCTGACTCTGCCACTTACGGG + Intronic
1155240026 18:23856138-23856160 ATCCCAACTCTACCACTTACTGG - Intronic
1155287279 18:24302936-24302958 ATCCTTACTCTTCCACTTACCGG - Intronic
1155438226 18:25834704-25834726 AGTCCTACTCTGCTACTTGCCGG - Intergenic
1156493916 18:37513286-37513308 ATCCCTACTCTGCCACATGCAGG + Intronic
1157941682 18:51935630-51935652 ATCCCTACTTTGCCACTTGCAGG - Intergenic
1162196855 19:8991641-8991663 ATCCCACCTCTGCTACTTTCTGG - Intergenic
1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG + Intronic
1167288452 19:48612058-48612080 ATCCCCACTCGGCCACTTACAGG + Intronic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
1168397713 19:56063223-56063245 ATGGCAGCTCTGCTACTTACTGG - Intergenic
925234338 2:2264968-2264990 ATTCCTGCTCTATAACTTACTGG + Intronic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926961211 2:18360362-18360384 ATCCCAGCTCTGCTTCTTACTGG + Intronic
930080600 2:47444658-47444680 ATCCCAGCTCTGCTACCTACTGG - Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
930731070 2:54728530-54728552 AATCCCACTCTGCCATTTACCGG + Intronic
930857193 2:56031477-56031499 ATGCCTCCTCTGCTACCTACCGG + Intergenic
932137064 2:69240745-69240767 AATCCCACTCTGCCACTTACTGG + Intronic
932286301 2:70534969-70534991 ATCCTTATTCTGCTACTTGCTGG + Intronic
933198827 2:79424400-79424422 AATCCTGCTCTGCTATGTACTGG - Intronic
935521800 2:104115733-104115755 ATACCTACTCTCATACTAACAGG - Intergenic
936648992 2:114404710-114404732 AATCCCACTGTGCTCCTTACAGG - Intergenic
936681268 2:114775027-114775049 ATTCCATCTCTGCCACTTACTGG - Intronic
938443544 2:131357079-131357101 ATTCCAACTCCACCACTTACTGG + Intergenic
940305054 2:152216623-152216645 ATAGCTACTCTGCTACTTGCAGG - Intergenic
941501385 2:166281932-166281954 ATTATGGCTCTGCTACTTACTGG + Intronic
943209291 2:184942134-184942156 ATCTCTAGTCTGCTAGTTACAGG + Intergenic
944127394 2:196309962-196309984 ATTCCTACTTTGTTAGTTCCAGG - Intronic
945827130 2:214735603-214735625 ATTCCCATTCTGCCACTTAATGG - Intronic
945923037 2:215775787-215775809 ATGCCTGCTTGGCTACTTACTGG - Intergenic
946039901 2:216774536-216774558 ATTTCTACTCTGCTTCTTTTCGG - Intergenic
946333639 2:219023875-219023897 TTCCCTACTATGCTACTTCCTGG + Intronic
1168913055 20:1465614-1465636 ATTCCAACCCCGCTACTTACTGG + Intronic
1169183134 20:3588714-3588736 ATTCCTCCTCCTCTATTTACTGG + Intronic
1169448202 20:5689704-5689726 TTTCCTACTCTGTTACATAAGGG - Intergenic
1171411702 20:24952309-24952331 ATTCCAGCTCTGCTTCTCACTGG - Intronic
1172064661 20:32210470-32210492 ATTCCAGCTCTCCTACTCACAGG - Intronic
1172336851 20:34123539-34123561 ATTCCATCTCTGTTACTCACTGG - Intergenic
1172373163 20:34412028-34412050 ATTACAGTTCTGCTACTTACTGG + Intronic
1172901605 20:38339047-38339069 ATTCCAACTCTGCCACCTGCTGG - Intergenic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1173840831 20:46155934-46155956 ATGCCAACTCTGCTATTTACCGG + Intergenic
1174170866 20:48617553-48617575 ATTCCAGCTCTGCCACTTGCTGG - Intergenic
1174580311 20:51566789-51566811 ATCCCACCTCTGCCACTTACTGG - Intergenic
1174678364 20:52379611-52379633 CTCCCAACTCTGCTACTTAATGG - Intergenic
1174917438 20:54668506-54668528 GTTCCTGTTCTGCTGCTTACAGG + Intergenic
1175154948 20:56964465-56964487 ATTCCAGCTCTGCCCCTTACCGG + Intergenic
1175607568 20:60323470-60323492 ATTCCCATTCTGACACTTACTGG + Intergenic
1175608323 20:60329656-60329678 CTTCCTGCTCTGCTGCTTTCTGG - Intergenic
1177202697 21:17975663-17975685 ATTCCTTCTGTACTATTTACTGG + Intronic
1177671120 21:24228982-24229004 ATTCCTACTCGGCTCCTGATTGG - Intergenic
1178696874 21:34800501-34800523 CTTCCTACACTGCTACCTGCAGG - Intronic
1181879222 22:25964378-25964400 ATTCTGACTCTGCCATTTACTGG - Intronic
1181882038 22:25988883-25988905 ATCCCAACTCTGCTGCTCACTGG - Intronic
1182758101 22:32697316-32697338 AATCCTGCTCTGCCATTTACTGG + Intronic
1182779859 22:32858890-32858912 AGTCTAATTCTGCTACTTACTGG + Intronic
1184268214 22:43361684-43361706 ATTCCTCCTCTGCAAATTGCTGG - Intergenic
949382765 3:3464410-3464432 ATTCCAGCTCTGCTACTTCTTGG + Intergenic
949408597 3:3740401-3740423 GTTCCTGCTCTGCCACTTACTGG - Intronic
949711783 3:6879205-6879227 ATTTTTAATCTACTACTTACTGG - Intronic
949945921 3:9190090-9190112 ATCCCTACTTTGTCACTTACTGG - Intronic
951656231 3:25011692-25011714 ATACCTACTCTGGCAATTACTGG + Intergenic
951696200 3:25448119-25448141 ATCCTCACTCTCCTACTTACTGG - Intronic
952518778 3:34133113-34133135 ATGCATGCTCTGCTACTCACAGG + Intergenic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
952926631 3:38325357-38325379 ATTCCTAACCTGCTACCTATAGG - Intergenic
955825127 3:62938015-62938037 TTTCCTACTCTCTTTCTTACTGG + Intergenic
956027604 3:65000224-65000246 ATTTCAGCTCTGCTACTTCCTGG - Intergenic
956199674 3:66693361-66693383 ATTCCTACTCTGGTATTTCTAGG + Intergenic
957780149 3:84808632-84808654 ATCCCTACTCAACTACTTTCTGG + Intergenic
959137218 3:102438418-102438440 ACTCCTTCACTCCTACTTACTGG - Intronic
962111343 3:132452498-132452520 ACTCCTACTCTGCCCTTTACAGG + Intronic
963951973 3:151212232-151212254 ATTCTTTCTCTGCTATTAACTGG - Exonic
964023674 3:152045364-152045386 ATTCCAGCTCTGATACTTGCTGG - Intergenic
964380321 3:156092120-156092142 ATTCTGATTCTGCCACTTACTGG + Intronic
965835601 3:172848493-172848515 ATCCCAGCTCTGCTATTTACTGG + Intergenic
965944923 3:174229045-174229067 TTTCCAGCTCTGCTACTTCCTGG + Intronic
966287974 3:178320171-178320193 ATTCCTACAGTGCTATTTAAAGG + Intergenic
966440899 3:179942917-179942939 ATTCTGGCTCTGCTACTTATGGG + Intronic
966571668 3:181450964-181450986 ATCCCAACTCTGCCACTTATTGG + Intergenic
966780156 3:183577420-183577442 ATCCCTGCTCTGCCACTTACTGG - Intergenic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
966850247 3:184160476-184160498 ATTCCAATTCTACCACTTACTGG - Intronic
967129687 3:186458987-186459009 AATCCTGCTCTGCTGCTTACTGG - Intergenic
967437056 3:189459464-189459486 ATTCCGAGTCTACTACTGACTGG - Intergenic
969847980 4:9934609-9934631 AATCCAGCTCTGCTACTAACTGG - Intronic
970551349 4:17185031-17185053 ATACCTACTGTGCAACCTACAGG + Intergenic
971088367 4:23307243-23307265 ATTCTTACTTTGCTACTTTCTGG + Intergenic
971328721 4:25664995-25665017 AATCTTACTCTGCTAATCACAGG - Intronic
971396194 4:26229639-26229661 ATCCCATCTCTGCCACTTACTGG + Intronic
971646425 4:29211385-29211407 ATTATTGCTCTGCCACTTACTGG + Intergenic
971867040 4:32185999-32186021 ATGCCAACTCTGCAATTTACTGG - Intergenic
972608758 4:40637781-40637803 ATCCCATCTCTGCCACTTACTGG + Intergenic
973017619 4:45161001-45161023 ATGCCTACGATGCTGCTTACTGG - Intergenic
973804154 4:54509328-54509350 ATTCCGGCTCTGCCACTCACCGG + Intergenic
974408028 4:61501106-61501128 ATTCCAGCTCTGCCACCTACTGG + Intronic
974503793 4:62740379-62740401 ATTTCAGCACTGCTACTTACTGG + Intergenic
976671248 4:87656544-87656566 ATCCCTACCCTAATACTTACTGG - Exonic
977415699 4:96730195-96730217 ATGCTTGCTCTGGTACTTACTGG + Intergenic
978225835 4:106334121-106334143 ATTGCTACTCTGCTGCTTGTTGG + Intronic
979784353 4:124697012-124697034 ATTACTGCACTGGTACTTACAGG + Intronic
979929263 4:126610509-126610531 CTTCCTGCTCTCCTACTCACTGG - Intergenic
980661040 4:135858417-135858439 ATTCCTATTCTTCTTCCTACAGG - Intergenic
980877618 4:138677787-138677809 ACTCCTTCTCTGCCACTCACAGG + Intergenic
981717970 4:147770695-147770717 ATTCCACCTCTGCTACATACTGG + Intronic
983315079 4:166121652-166121674 ATTGCAGCTCTTCTACTTACAGG - Intergenic
984124945 4:175796511-175796533 ATTCTAACTCTGCTATATACTGG - Intronic
984221731 4:176986444-176986466 CTTCCTACCCTACTAATTACTGG + Intergenic
987101730 5:14597053-14597075 ATTCTGGCTCTTCTACTTACTGG + Intronic
988011285 5:25489435-25489457 ACTCCTGCTCTGCTTCATACTGG + Intergenic
988313455 5:29592954-29592976 TCTCCTACTCTGCTCCTTTCTGG - Intergenic
988491664 5:31710448-31710470 ATTCCGGCTCTGCAGCTTACTGG + Intronic
990091230 5:52052113-52052135 ATGCCTACTCTGCTATTTGAGGG - Intronic
991008162 5:61852742-61852764 ATTCCAACTATGCTACATTCTGG + Intergenic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
992160777 5:73999061-73999083 ATTCTGGCTCTGCCACTTACTGG - Intergenic
994261492 5:97664525-97664547 ATTTCAACCCTGCTACTTAGTGG + Intergenic
994746484 5:103684958-103684980 ATTCCTACCCTACTGCTTCCAGG - Intergenic
995072417 5:107940151-107940173 ATGACAACTCTGCCACTTACTGG - Intronic
995435583 5:112131437-112131459 GTTCCAGCTCTGCTACTAACTGG - Intergenic
996671782 5:126126485-126126507 ATTCCCACCCTGATACTTACTGG - Intergenic
998792685 5:145782322-145782344 ATTCCAGCTCTGCCACTTACTGG + Intronic
999308930 5:150538976-150538998 ATTCCCACTCTGTTACTTTGAGG + Intronic
999538717 5:152548491-152548513 ATTCCTTCTCTACAACTTCCAGG - Intergenic
999661759 5:153871715-153871737 ATGCCTACTCTGTTTCTTAATGG - Intergenic
999772407 5:154785579-154785601 CTACCTACTCTGCTCCTCACAGG - Intronic
1001363304 5:171110161-171110183 ATTCCAACTCTGTTACTTCCTGG + Intronic
1001669561 5:173462680-173462702 ATTCTCACTCTACTATTTACTGG - Intergenic
1001712190 5:173787826-173787848 ATTTTAGCTCTGCTACTTACTGG + Intergenic
1001713911 5:173799110-173799132 ATGCCTGCTCTGCTACTTGCTGG + Intergenic
1001861336 5:175058277-175058299 ACCCCTACTCTGATGCTTACTGG + Intergenic
1003609143 6:7592654-7592676 ATTCCATCTCTGCCACTTACTGG - Intronic
1004115201 6:12759890-12759912 ATCCTCACTCTGCCACTTACTGG + Intronic
1004817528 6:19328751-19328773 ATTCCTACACTGCTGCTTCAGGG - Intergenic
1005006823 6:21295681-21295703 ATTCCCACTCTGCTTCATCCCGG - Intergenic
1006735198 6:36268406-36268428 ATCCCAACTCTGCTATTTACAGG - Intronic
1008138885 6:47808976-47808998 ATTTCTCCTCTGCTACTTTCTGG - Intronic
1008653747 6:53589878-53589900 ATTACTATTCTATTACTTACAGG + Intronic
1009024406 6:57981459-57981481 TTTCTTGCTCTGCTTCTTACTGG + Intergenic
1009199988 6:60732945-60732967 TTTCTTGCTCTGCTTCTTACTGG + Intergenic
1009778484 6:68237330-68237352 ATTCCAACTCTGCCATTTAATGG - Intergenic
1010078116 6:71825260-71825282 ATTCCATCTCTTCTACTTTCTGG + Intergenic
1010618077 6:78038589-78038611 ATTAGGACTCTGCTGCTTACTGG - Intergenic
1011274904 6:85621290-85621312 ATTCCCTCTTTGTTACTTACAGG - Intronic
1012146602 6:95691970-95691992 ACTCCTAAACAGCTACTTACAGG + Intergenic
1012627335 6:101420217-101420239 ATTCTTACTCTGAAATTTACTGG - Intronic
1015509246 6:134021679-134021701 ATCCCAGCTCTTCTACTTACTGG - Intronic
1018089421 6:160332843-160332865 ATTCCAACTCTGCTTCTTAGTGG + Intergenic
1018774793 6:167003797-167003819 ATTCTTACTGTGCTAGTTTCAGG - Exonic
1021953420 7:25797922-25797944 AATCCTACTCTGGCACTTTCTGG - Intergenic
1022330640 7:29375535-29375557 ATTCCAACTCTACTAATTAAGGG - Intronic
1022576121 7:31498564-31498586 ATTCTTACTCTACAACTCACTGG - Intergenic
1022588039 7:31634524-31634546 ATTCTGACTCTCCTACTTAGAGG - Intronic
1023157963 7:37270258-37270280 ATGCCTGCTTTGCTACTTAATGG - Intronic
1023344919 7:39261625-39261647 ATCCCGCCTCTGCCACTTACAGG - Intronic
1025720302 7:64004794-64004816 ACTCAGACTCTGCCACTTACTGG + Intergenic
1026489309 7:70849017-70849039 ATTCAAACTCTGCAACTAACTGG - Intergenic
1028279049 7:88897809-88897831 AATCCTACTTTACTACTTGCTGG + Intronic
1028850980 7:95537165-95537187 AATCTTATTCTGCTACTTATTGG + Intronic
1029670004 7:102023348-102023370 ATGCAGACTCTGCCACTTACTGG - Intronic
1030289941 7:107862072-107862094 ATTGCTACTCTGATACTAGCAGG + Intergenic
1030671305 7:112340207-112340229 ATTCCAGCTCTGGCACTTACTGG + Intronic
1030704128 7:112673751-112673773 ACTACTACTCTGCTACATACAGG - Intergenic
1031976446 7:128096713-128096735 ATCCCTAGTGTGCTACCTACAGG - Intergenic
1032713191 7:134480822-134480844 ATTCCAACTCTGCTTTTTACTGG - Intergenic
1033602075 7:142895686-142895708 AATCAGACTCTGCTAATTACTGG + Intergenic
1033771966 7:144562823-144562845 AGTTCTATTCTGCTACTTATTGG + Intronic
1036058125 8:5283046-5283068 TTTCCTACTGGGCTAGTTACTGG + Intergenic
1038952487 8:32431135-32431157 ATCCCAACTCTGCCACTAACTGG - Intronic
1038974709 8:32681103-32681125 ATTCCTACTCTCTTACTGAAAGG - Intronic
1042259181 8:66839144-66839166 ATTCCATCTCTGCTCCTTTCTGG - Intronic
1043284296 8:78510099-78510121 ATTCCTACTCTGCTCCTTCATGG + Intergenic
1043933518 8:86117586-86117608 ATTCCTTCCATGTTACTTACAGG + Intronic
1043959327 8:86397969-86397991 ATTCCAGTTCTGCTACTTATTGG - Intronic
1044486402 8:92759547-92759569 ATACCTGCTCTGTTACTTCCTGG - Intergenic
1044717105 8:95110618-95110640 ATCCCAGCTTTGCTACTTACTGG - Intronic
1046135532 8:110021217-110021239 ACTCCAACTCTGCCACTGACTGG + Intergenic
1046958075 8:120082270-120082292 ACTCCATCTCTGCCACTTACAGG - Intronic
1047005889 8:120620404-120620426 ATCCCCAGTTTGCTACTTACTGG - Intronic
1047155758 8:122316148-122316170 ATTCCTACATTGCTATTTAGTGG - Intergenic
1047178390 8:122564083-122564105 ATTTCAGCTCTGCTGCTTACCGG + Intergenic
1047735076 8:127757966-127757988 ATACCTACTCTACCACTTGCTGG - Intergenic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1049145105 8:140994729-140994751 ATTCCCACTATTCCACTTACTGG + Intronic
1050301952 9:4268139-4268161 ATCCTGACTCTGCCACTTACAGG + Intronic
1051590490 9:18772524-18772546 ATCCTGACTCTGCCACTTACTGG + Intronic
1053005228 9:34599867-34599889 ATACCTACTCTACTACCTACTGG + Intergenic
1054967210 9:71043239-71043261 ATTCCAACTCTGGTAGTTAGTGG + Intronic
1055213291 9:73825871-73825893 AATCTAACTCTGCTAATTACAGG - Intergenic
1057324794 9:94051492-94051514 ATCCCTACTCTTCTACTTTCTGG + Intronic
1057772292 9:97979337-97979359 AATCCCACTCTACCACTTACTGG - Intergenic
1058015086 9:100022424-100022446 AATCCTAATTTGCGACTTACTGG + Intronic
1058287725 9:103201209-103201231 ATTCCTTCTCTGTTACATAAGGG + Intergenic
1058911264 9:109522001-109522023 ATTCCAGCTCTGCCACTGACAGG - Intergenic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1060081499 9:120651419-120651441 ATTCCAACTCTTTTACTTACTGG + Intronic
1061168943 9:128940914-128940936 ATCCACACTCTGCTACTTATGGG + Intronic
1061357810 9:130119565-130119587 ATTCCAACTCTGCTGCTCACTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1185840781 X:3389471-3389493 ATGCCTACTCTTCCAGTTACTGG + Intergenic
1187075749 X:15932753-15932775 ATTCCCACTCTGTTACTTACAGG + Intergenic
1187294042 X:17981739-17981761 ATCCCTACTCTCCTATTTTCTGG - Intergenic
1187975079 X:24696764-24696786 ATTCCAGCTCTGCCATTTACTGG - Intronic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1193890516 X:87039954-87039976 ATTCCAATTCTCCTACTTAATGG + Intergenic
1194650428 X:96508087-96508109 ACCCCAACTCTGCCACTTACTGG - Intergenic
1196022398 X:111003892-111003914 ATACTGACTCTGCAACTTACTGG + Intronic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1196750096 X:119108252-119108274 ATTCCTACTCTGCTACTTACTGG - Intronic
1197263697 X:124343863-124343885 ATTTCAACTCTCCTACTTACTGG + Intronic
1197272870 X:124444970-124444992 ATTCCAACTCAGCCACTTATTGG + Intronic
1198581282 X:138067494-138067516 TTTCCAACTCTGCTCTTTACAGG - Intergenic
1198829277 X:140731458-140731480 ATTCTGTCTCTGCCACTTACTGG + Intergenic
1198985916 X:142453416-142453438 ATTCCTACTCTGCTTGCTAATGG + Intergenic
1199018871 X:142852014-142852036 ATACTTCCTCTTCTACTTACTGG + Intergenic
1199582559 X:149374928-149374950 ATTGCAACTCTACTATTTACTGG + Intergenic
1199932274 X:152535535-152535557 ATTCCTACACTGCTCACTACAGG + Intergenic
1201697954 Y:16847392-16847414 CATCCTACTGTCCTACTTACAGG - Intergenic