ID: 1196750813

View in Genome Browser
Species Human (GRCh38)
Location X:119115873-119115895
Sequence TGCTATAGTCACAGGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196750813_1196750822 4 Left 1196750813 X:119115873-119115895 CCATGCCCCCTGTGACTATAGCA 0: 1
1: 0
2: 2
3: 12
4: 101
Right 1196750822 X:119115900-119115922 CCCTAGTCTCCTGAAATGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1196750813_1196750827 18 Left 1196750813 X:119115873-119115895 CCATGCCCCCTGTGACTATAGCA 0: 1
1: 0
2: 2
3: 12
4: 101
Right 1196750827 X:119115914-119115936 AATGGAGGGAGAAAGGGATCTGG 0: 1
1: 0
2: 8
3: 53
4: 647
1196750813_1196750828 19 Left 1196750813 X:119115873-119115895 CCATGCCCCCTGTGACTATAGCA 0: 1
1: 0
2: 2
3: 12
4: 101
Right 1196750828 X:119115915-119115937 ATGGAGGGAGAAAGGGATCTGGG 0: 1
1: 0
2: 3
3: 52
4: 719
1196750813_1196750818 0 Left 1196750813 X:119115873-119115895 CCATGCCCCCTGTGACTATAGCA 0: 1
1: 0
2: 2
3: 12
4: 101
Right 1196750818 X:119115896-119115918 TTTCCCCTAGTCTCCTGAAATGG 0: 1
1: 1
2: 2
3: 15
4: 205
1196750813_1196750820 3 Left 1196750813 X:119115873-119115895 CCATGCCCCCTGTGACTATAGCA 0: 1
1: 0
2: 2
3: 12
4: 101
Right 1196750820 X:119115899-119115921 CCCCTAGTCTCCTGAAATGGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1196750813_1196750824 11 Left 1196750813 X:119115873-119115895 CCATGCCCCCTGTGACTATAGCA 0: 1
1: 0
2: 2
3: 12
4: 101
Right 1196750824 X:119115907-119115929 CTCCTGAAATGGAGGGAGAAAGG 0: 1
1: 0
2: 5
3: 33
4: 344
1196750813_1196750825 12 Left 1196750813 X:119115873-119115895 CCATGCCCCCTGTGACTATAGCA 0: 1
1: 0
2: 2
3: 12
4: 101
Right 1196750825 X:119115908-119115930 TCCTGAAATGGAGGGAGAAAGGG 0: 1
1: 0
2: 2
3: 49
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196750813 Original CRISPR TGCTATAGTCACAGGGGGCA TGG (reversed) Intronic
900943020 1:5813434-5813456 TGCTATAGTCAATGTGGGCCAGG + Intergenic
903832426 1:26183161-26183183 GGCTATAGTCACCGGGGGCTGGG - Intronic
908166285 1:61462509-61462531 TACTAGAGGCACAGGGGGCCCGG - Intronic
908643371 1:66249679-66249701 TTCTAAAGTTACTGGGGGCAGGG - Intronic
913643300 1:120832973-120832995 TGCGAAAGTCACCTGGGGCATGG - Exonic
919341309 1:196311093-196311115 TGCTCTAGTCCCATGGGTCAGGG - Intronic
921058330 1:211561471-211561493 TGCAAAAGTGACAGGGGGCTGGG - Intergenic
921153534 1:212420286-212420308 TGGTATAGTCGCTGGGGGGAAGG + Intergenic
921948476 1:220905357-220905379 TGCTTTAGTCACAGTGAACAAGG - Intergenic
1069069472 10:63978472-63978494 TGTTACAGTCAGAGGGGACAAGG + Intergenic
1069277995 10:66616955-66616977 TTCTATATTCATAGAGGGCAGGG - Intronic
1073444908 10:103574772-103574794 ATTTATAGTCACAGGGGGGATGG - Intronic
1074099444 10:110342785-110342807 GGCTATCTTCACAGGGGCCAAGG - Intergenic
1076763335 10:132616513-132616535 TGCTGTGGTCACATGGGACATGG + Intronic
1076788763 10:132765230-132765252 TGGAAGAGTCTCAGGGGGCAAGG + Intronic
1076799246 10:132813062-132813084 TGCTCTGATCACAGGGGTCACGG + Intronic
1077460020 11:2704411-2704433 TGCTGTACCCACAGGTGGCATGG + Intronic
1078858002 11:15222020-15222042 TGCCATAGTCACTGGGCACAAGG - Intronic
1084445420 11:69200732-69200754 TGCTATTGTCTCAGGGCGCAGGG + Intergenic
1084524195 11:69685810-69685832 TGCAAAAGTTGCAGGGGGCAGGG + Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1086061712 11:82706791-82706813 AGCTAAACTCACAGGGGTCAAGG - Intergenic
1088039145 11:105355558-105355580 AGCTATAGTCATATGGGTCAGGG - Intergenic
1089104164 11:115988196-115988218 TGCTGTAGTTAGAGGGGGCAGGG - Intergenic
1089510971 11:118997012-118997034 TGCTATAGGCCCAGGGGGAATGG + Intergenic
1101321147 12:103674052-103674074 TGCTGTATTCACAGGTGGCGTGG - Exonic
1102502862 12:113364580-113364602 GCCTATAGTCACAGGAGGCTGGG - Intronic
1105453645 13:20521592-20521614 CGCAATAGTCACAGTGGGAAGGG - Intronic
1106385369 13:29280054-29280076 TGATATTTTCACATGGGGCATGG - Intronic
1115650189 14:35397542-35397564 TGCCACAGTCACTTGGGGCATGG + Intergenic
1117199443 14:53373267-53373289 TGCAATAGGCACAGGAGGCAGGG + Intergenic
1120950066 14:90032709-90032731 TGCTATAGTAACAGGCTGCCTGG - Intronic
1121081092 14:91108974-91108996 TGGTATAGGAACAGGGGGTATGG + Intronic
1121638183 14:95467730-95467752 AGCTAGTGTCACAGTGGGCAAGG + Intronic
1122877756 14:104676769-104676791 GGCTGATGTCACAGGGGGCAGGG - Intergenic
1124209075 15:27747214-27747236 TGTGACAGTCACATGGGGCAAGG + Intergenic
1129703396 15:77780930-77780952 TGCTATTGTCACAGCCCGCATGG + Intronic
1134410505 16:13999991-14000013 TGCTATGGTGACAGGAGGCATGG - Intergenic
1134849576 16:17469781-17469803 AGATAAAGTCACAGAGGGCATGG + Intronic
1135089059 16:19498031-19498053 TCCTAAAGGCACAGGTGGCATGG - Exonic
1139212361 16:65092106-65092128 TGCCATAGTCATAGATGGCAGGG + Intronic
1145751507 17:27358122-27358144 TGCTATGGTCAGAGGTGGAATGG - Intergenic
1150856326 17:68756649-68756671 TGCTATATTCACAGGGTGCATGG + Intergenic
1152254546 17:79230078-79230100 AGCTATTCTCACTGGGGGCAAGG + Intronic
1152642976 17:81456888-81456910 TGCTACAGTCACAGGGGCTGGGG - Intronic
1154002518 18:10494528-10494550 TGCTATAGTCAGTGTGGGGAAGG - Intergenic
1156438420 18:37158513-37158535 GGCCATAGTCACAGAGGGGATGG + Intronic
1157399615 18:47376631-47376653 TGTCAGAATCACAGGGGGCAGGG - Intergenic
1160411408 18:78677756-78677778 TACTATAGACCCTGGGGGCAGGG - Intergenic
1164622972 19:29708299-29708321 TGCCCTGGTCACAGGGGCCATGG - Exonic
1165458169 19:35927051-35927073 TGCTGTGGTCACAGGAGCCATGG + Intergenic
1166986751 19:46664894-46664916 TGCTATATTCACAGGTTCCAGGG - Intergenic
1167418524 19:49389710-49389732 TGCTATCATCACAGCGGGCACGG - Intronic
928160550 2:28920139-28920161 TTTTACAGTCACAGGGGGCCAGG - Intronic
928582176 2:32719829-32719851 TGGTATTCTCACAGGGGGAAAGG + Intronic
938737268 2:134197762-134197784 TGCTAAAGTTATAGGGGGCTGGG + Intronic
939036241 2:137134584-137134606 TTCCATAGTCACATGGGGCAAGG + Intronic
943043641 2:182832405-182832427 TGCTATATTCTCAGATGGCAAGG - Intergenic
944359677 2:198838686-198838708 TGCTATAGTGACATCGGTCAGGG - Intergenic
948289720 2:236816236-236816258 TGCTTTAGTGGCAGGGGGAATGG - Intergenic
1174910612 20:54603886-54603908 TGCTATAGCCTCAGGGGGAGGGG + Intronic
1175034101 20:55983528-55983550 AGAAATAGTCACTGGGGGCAGGG + Intergenic
1175457769 20:59128192-59128214 TGCAATAGTCACAGTGAGGAGGG + Intergenic
1180042440 21:45287434-45287456 TGGTATAGGGGCAGGGGGCAGGG - Intronic
1180727547 22:17957826-17957848 TGGTACAGTCACAGGGAGCCTGG + Intronic
1183075223 22:35422581-35422603 TGCTGCAGGCACAGAGGGCAGGG + Intronic
1184335294 22:43849273-43849295 TGTGATAGGGACAGGGGGCAGGG + Intronic
1185163470 22:49243668-49243690 TGCTGAACTCCCAGGGGGCATGG - Intergenic
1185191960 22:49443910-49443932 TCCCAGAGTCACAGGGGGCTGGG + Intronic
954878105 3:53816500-53816522 TTCTACAGCCACAGGGTGCATGG + Exonic
957809713 3:85204592-85204614 TGTTTTAGTCTGAGGGGGCAAGG - Intronic
961043117 3:123691355-123691377 TGCTCAATTCAGAGGGGGCATGG - Intronic
961623816 3:128245369-128245391 TGCTACAGCCACAGAGGGGATGG - Intronic
961936370 3:130588754-130588776 TGCTAGAGTGAGATGGGGCAGGG + Intronic
962729097 3:138263240-138263262 TGCTATAGTGAAAGATGGCAAGG + Intronic
967484088 3:190009879-190009901 TCCTCTACTCACATGGGGCAAGG - Intronic
968566477 4:1316216-1316238 AGCTGTAGCCACAGAGGGCAAGG - Intronic
970300891 4:14680447-14680469 TCCCATAGTCAAAGGGGCCATGG - Intergenic
970842547 4:20491804-20491826 TGCTACAGGTACAGGCGGCAGGG - Exonic
979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG + Intergenic
987446658 5:18028336-18028358 AGCTACAGTCACAAGAGGCAGGG - Intergenic
989581911 5:43041472-43041494 TGCTATTGTCAAAGGGAGCTTGG + Intronic
990188681 5:53233747-53233769 AGCTATAGTCAGACTGGGCATGG - Intergenic
992741192 5:79774975-79774997 TCCTTTAGCCACAGGGTGCAAGG - Intronic
993204320 5:84860989-84861011 AGCTGCAGTCACAGAGGGCAGGG - Intergenic
997653139 5:135536609-135536631 TGCCAGAGGCACAGGGCGCAGGG + Intergenic
999933126 5:156455518-156455540 TGTTATGGACACAGGGGCCAAGG - Intronic
1000232505 5:159329235-159329257 AGATATAGTCACAGATGGCATGG + Intronic
1002616118 5:180457565-180457587 TGCTACAGACACAGGAGGCACGG + Intergenic
1004000988 6:11597076-11597098 TGGTTTAGTGACATGGGGCAAGG - Intergenic
1015255875 6:131179057-131179079 TACTCTACTCACAGTGGGCAGGG - Intronic
1015700691 6:136033105-136033127 GGCTATAGTCAGAGGGTGCCAGG + Intronic
1017720962 6:157242841-157242863 TGCTATCGCCACAGGGGTCTGGG + Intergenic
1018142989 6:160858417-160858439 TGCTACAGTAACATGGGGTATGG - Intergenic
1019618016 7:1975279-1975301 TGCTATGGTCCCAGGTGGGAAGG - Intronic
1034398493 7:150846063-150846085 TGCAATAGTCTTGGGGGGCAAGG - Intronic
1038761594 8:30389237-30389259 TGCCATATTGACAGGGGTCATGG - Intronic
1039055864 8:33535922-33535944 TTCTAAAGTCACAGGGGGCAGGG - Intergenic
1039631906 8:39121663-39121685 TGCTACAGGCCCAGGAGGCAAGG + Intronic
1041868461 8:62604951-62604973 TGCTCTCGTCACAGGTGGCAGGG + Intronic
1044894035 8:96869431-96869453 CTCTATAGTCACACTGGGCATGG + Intronic
1045834891 8:106508089-106508111 AGAAATAGACACAGGGGGCAAGG - Intronic
1050279149 9:4032773-4032795 TGCTATTGGCAGTGGGGGCAGGG - Intronic
1050744547 9:8859986-8860008 TCCTTAGGTCACAGGGGGCAAGG - Intronic
1056465177 9:86846742-86846764 TGCTACAGACACAGAGGGCAGGG + Intergenic
1056915317 9:90741045-90741067 TGTGATAGTCACTGTGGGCATGG + Intergenic
1058858930 9:109095309-109095331 TACTATACTCCCTGGGGGCAGGG - Intronic
1060109000 9:120893364-120893386 TGCTATAATCAGAGGGGCCCTGG - Intronic
1060223071 9:121774542-121774564 TGCTATTCTCACAGGGAACAGGG - Intronic
1188816266 X:34718497-34718519 AGCTAAAGACCCAGGGGGCAAGG - Intergenic
1189237874 X:39502174-39502196 TGCTGTAGGCAGAGGGGTCAGGG + Intergenic
1193022043 X:76801473-76801495 TGCTAAAGTCACAGGGGAGCTGG - Intergenic
1195980173 X:110568916-110568938 TGCTTTATTCAGAGTGGGCAGGG - Intergenic
1196750813 X:119115873-119115895 TGCTATAGTCACAGGGGGCATGG - Intronic
1200067727 X:153512194-153512216 AGCTCTAGTCTCAGGAGGCAGGG + Intergenic