ID: 1196750964

View in Genome Browser
Species Human (GRCh38)
Location X:119116892-119116914
Sequence GGCCACAGCTTGTCATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196750958_1196750964 30 Left 1196750958 X:119116839-119116861 CCTTAATAACTCAGTAACAAAGT 0: 1
1: 0
2: 0
3: 9
4: 198
Right 1196750964 X:119116892-119116914 GGCCACAGCTTGTCATCTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196750964 Original CRISPR GGCCACAGCTTGTCATCTCT GGG Intronic
901355639 1:8645630-8645652 GGCCACAGATTGGCATCCCATGG - Intronic
901489753 1:9590557-9590579 GGCCACAGCTCTCCATCTCCTGG + Intronic
901526775 1:9828085-9828107 GGCCACACCTTGTAATTTCTGGG - Intergenic
903070942 1:20726783-20726805 GGCCACAGCTTCCCACCCCTGGG - Intronic
903127539 1:21258098-21258120 GGCCACATCTTGGCATACCTAGG + Intronic
916097288 1:161362664-161362686 GCCCACAGCTTGCCTACTCTCGG + Exonic
918391884 1:184073890-184073912 TGCCATAGTTTGTCATCCCTGGG + Exonic
921137135 1:212271754-212271776 GGACACAGATTGTGCTCTCTTGG - Intergenic
922810896 1:228414976-228414998 GGCCACAGGTGGTCATCACAGGG + Exonic
1064709980 10:18113021-18113043 GGCATCAGCTTGTGCTCTCTGGG - Intergenic
1064951185 10:20852741-20852763 GGCAACAGCTTTGCAGCTCTTGG - Intronic
1066196924 10:33109503-33109525 AGCCTCAGCTTGAGATCTCTTGG + Intergenic
1066617582 10:37311118-37311140 GACCACAGCATCTCATCTCTGGG + Intronic
1072461717 10:95625126-95625148 AGCCACAGCTTGTGACCTGTGGG + Intronic
1077087598 11:762310-762332 GGCCACAGTTATTCATCTGTTGG + Intronic
1078065874 11:8079291-8079313 GGTCAAAGCTTCTGATCTCTAGG + Intronic
1078857538 11:15218982-15219004 GACCACAGCTTGTTAACTCTTGG - Intronic
1080662374 11:34307625-34307647 GGACACAGATTGTGCTCTCTTGG + Intronic
1081126373 11:39328366-39328388 GCTCACAGCTTATCATTTCTAGG + Intergenic
1086399169 11:86446751-86446773 GGCCACATCCTGTCATGTCCTGG - Intronic
1090422731 11:126586781-126586803 GGACACAGCTTTGCATCACTTGG + Intronic
1093860470 12:24159944-24159966 AGGCAAAGCTTCTCATCTCTGGG + Intergenic
1095173540 12:39062741-39062763 GGCCAATGCCTGTCATCTCCTGG - Intergenic
1095974175 12:47928010-47928032 GAGCACAGCTTGTTATCTTTGGG + Intronic
1106864092 13:33944793-33944815 GGCAATATCTTCTCATCTCTTGG - Intronic
1107040837 13:35945466-35945488 GGCCACAGCTTCCAAACTCTGGG - Intronic
1107283041 13:38758085-38758107 GTCTAAAGCTTGTCATCCCTCGG + Intronic
1112970356 13:105254043-105254065 GGCCACAGCTTCTCTTACCTTGG + Intergenic
1113293550 13:108932591-108932613 GGCCACAGCCAGCCCTCTCTTGG - Intronic
1123927204 15:25127822-25127844 GTCCACAGATTGTCAACTATGGG - Intergenic
1126058441 15:44755043-44755065 GGCCACAGCTTAGCATCAGTGGG - Exonic
1126357850 15:47815138-47815160 TGACACAGCCTGTAATCTCTTGG + Intergenic
1126729787 15:51671244-51671266 GGACAAAGCTTGTCATATTTTGG + Intergenic
1127300785 15:57651513-57651535 AGCCATAGGTTGTCATCACTGGG + Intronic
1129911200 15:79227964-79227986 GGCCATTGCTGGTCATCTCTGGG + Intergenic
1130091434 15:80824364-80824386 GGCCTCAGATTCTCATCTTTTGG + Intronic
1131323527 15:91420854-91420876 GGTCACAGCTTGGAATGTCTTGG + Intergenic
1131726656 15:95234082-95234104 GGCTACAGTTTGCCAACTCTTGG + Intergenic
1133084236 16:3349446-3349468 GGCCACAGCTTTTAACCTCGGGG - Intergenic
1134104845 16:11478012-11478034 GGCCCCCGCTTATCATTTCTTGG - Intronic
1134354644 16:13469938-13469960 GGCCACTTATTGTCATCTCTTGG + Intergenic
1134863519 16:17583495-17583517 AGCCACAGCCTTTCATTTCTGGG - Intergenic
1136552707 16:30990096-30990118 GCCCACAGCTGCCCATCTCTGGG - Exonic
1136736520 16:32472134-32472156 GGCCTCAGCATGTCTTGTCTGGG + Intergenic
1136774707 16:32865657-32865679 GGCCACAGCATGGAATCTTTTGG + Intergenic
1138400841 16:56742328-56742350 GGCCATAGTTTGCCAACTCTTGG - Intronic
1138423036 16:56912256-56912278 GGCCACAGCTGCCCAGCTCTGGG - Intronic
1139593302 16:67944779-67944801 GACCACAGCTTGTTATGTCCTGG + Exonic
1141367826 16:83460234-83460256 TGCCAAAGCTTGGCATTTCTAGG - Intronic
1203016550 16_KI270728v1_random:357444-357466 GGCCTCAGCATGTCTTGTCTGGG - Intergenic
1203034885 16_KI270728v1_random:630602-630624 GGCCTCAGCATGTCTTGTCTGGG - Intergenic
1203077134 16_KI270728v1_random:1127793-1127815 GGCCACAGCATGGAATCTTTTGG + Intergenic
1142731034 17:1857786-1857808 GCCCACAGCTTGCCTACTCTCGG - Intronic
1143867783 17:9936426-9936448 GGCCTGAGAATGTCATCTCTGGG + Intronic
1145018192 17:19412321-19412343 GGGCAGAGCTTGGCCTCTCTGGG + Intronic
1146832068 17:36078342-36078364 GGCCCCAGCTTCTCAAATCTTGG + Intergenic
1147647228 17:42040973-42040995 GGCCACTGCTGGCCAGCTCTTGG - Intronic
1154065698 18:11104944-11104966 GGCCACAGCGTGTCCTCTCTGGG + Intronic
1156135136 18:34028601-34028623 GGCCAAAGGATTTCATCTCTTGG + Intronic
1156866650 18:41896055-41896077 GGCCTCAGCTTCTCCTCTTTAGG - Intergenic
1159471833 18:68867339-68867361 GCCCACAGCTTGCCTACTCTGGG + Intronic
1159982241 18:74797450-74797472 GTCGACAGCCTGTCATCTGTTGG - Intronic
1160606620 18:80056047-80056069 GGTCTCAGATTTTCATCTCTAGG + Intronic
1160627952 18:80225870-80225892 GAGCACACCTAGTCATCTCTGGG + Intronic
1161182015 19:2889941-2889963 GGTCACACCTTTGCATCTCTAGG + Intergenic
1162791557 19:13065673-13065695 GGCCACTGCCTGTCATCCCTTGG + Intronic
1163019811 19:14475902-14475924 GGCCACAGCGAGTCATATCCTGG + Intergenic
1163228058 19:15979057-15979079 GGCCCCACCCTTTCATCTCTAGG - Intergenic
1167230593 19:48280504-48280526 GTCCACTGCTTGTCATCTGCAGG - Intronic
925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG + Intronic
926225342 2:10963112-10963134 GGACATATCTTTTCATCTCTTGG + Intergenic
927099561 2:19777469-19777491 GCACACAGCTTGGCATCTGTAGG - Intergenic
927893913 2:26769325-26769347 GGCCTCAGCTTGTCCCCGCTAGG + Intronic
929950794 2:46408310-46408332 GCCCATATCTAGTCATCTCTAGG - Intergenic
931650595 2:64465446-64465468 GGATACAGCTTGCCATGTCTTGG + Intergenic
932475598 2:72003903-72003925 GGCCACAGCTTGTCTGTTCAAGG - Intergenic
932783753 2:74581171-74581193 GGGCACAGGTTGTCCTCCCTGGG + Intronic
932940244 2:76155810-76155832 GGCCACAGTTTGTCAGCCCCTGG - Intergenic
933768643 2:85729082-85729104 GGCTCCAGCTTCTCGTCTCTGGG - Intergenic
934187680 2:89761255-89761277 GGCCTCAGCATGTCTTGTCTGGG + Intergenic
935622701 2:105143700-105143722 GGCCTCACCTGGTCACCTCTAGG - Intergenic
938196620 2:129334386-129334408 GGCCATGGCTTGTCCTCCCTGGG + Intergenic
938900622 2:135796213-135796235 GGCCTCAGCAGGGCATCTCTGGG - Intronic
939817367 2:146912260-146912282 GGTCACATTTTGTCAACTCTTGG + Intergenic
942127719 2:172844225-172844247 GGCCTCACCCTGTCCTCTCTTGG + Intronic
945001385 2:205354706-205354728 GGTCACTGTTTGTAATCTCTGGG - Intronic
946147036 2:217738843-217738865 GGCCACAGCGTGACTTCTGTGGG - Intronic
946743389 2:222822203-222822225 AGCAACATATTGTCATCTCTTGG - Intergenic
947708180 2:232293228-232293250 AGCCACAGCTGGTCATCTGGTGG + Intronic
948034109 2:234843871-234843893 TGCCATAACTTGTCAACTCTGGG - Intergenic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1172153244 20:32805403-32805425 GGCCACAGCTCGTCTTACCTTGG - Exonic
1173338899 20:42136632-42136654 GGACACAGGTGGTCCTCTCTTGG - Intronic
1174839565 20:53888774-53888796 GGCCACAGTTTGCCAACTCCTGG - Intergenic
1175470809 20:59226134-59226156 GACCACTCCTTTTCATCTCTTGG - Intronic
1177920992 21:27152413-27152435 GGCCACATCTTGGCAGCCCTGGG - Intergenic
1178598488 21:33975971-33975993 CGCCACAGCTTTTTATATCTTGG + Intergenic
1179966429 21:44809202-44809224 GGCCACTGCTTTTCCTCTCCAGG - Intronic
1180536028 22:16393786-16393808 GGCCTCAGCATGTCTTGTCTGGG - Intergenic
1180801838 22:18635570-18635592 GCCAGCAGCTTCTCATCTCTTGG + Intergenic
1180853076 22:19031111-19031133 GCCAGCAGCTTCTCATCTCTTGG + Intergenic
1181219882 22:21359691-21359713 GCCAGCAGCTTCTCATCTCTTGG - Intergenic
1183167042 22:36155851-36155873 GGACACAGCATGTCCTCCCTGGG + Intronic
1183954198 22:41369333-41369355 GGCCACAGCTTGCCAGTGCTCGG - Intronic
1184664516 22:45980771-45980793 GGCCCCAGATGGTCACCTCTGGG + Intergenic
949426181 3:3918608-3918630 GGCCGCCGCTTATCATCTCTGGG + Intronic
950924382 3:16725999-16726021 GGCAAAAGCTAGTCCTCTCTCGG - Intergenic
951339302 3:21465442-21465464 GGCCACAGCCTCTCATCACCTGG + Intronic
954775274 3:53011555-53011577 GCCCACAGCCTTTGATCTCTGGG - Intronic
954801500 3:53189680-53189702 GCCCAGAGCCTGTCATCTCCGGG + Intronic
955415275 3:58685859-58685881 GGTCTCAGCATGTCCTCTCTTGG + Intergenic
959343489 3:105161709-105161731 TGTCAAAGCTTGTCATTTCTTGG + Intergenic
961469491 3:127102308-127102330 GGCAGCAGCTGCTCATCTCTAGG + Intergenic
961866182 3:129955023-129955045 GGCCACAGCTTCCCATCCCATGG + Intergenic
963798543 3:149655566-149655588 TGCCACAGCTGGTCTTCTCTGGG - Intronic
964384862 3:156136780-156136802 GGCCACATTTTGGCATCTTTTGG + Intronic
965376906 3:167936161-167936183 GGACACAGCTTGTCAAACCTTGG + Intergenic
969274205 4:6124224-6124246 GGCCACAGGTGGCCCTCTCTGGG - Intronic
974984224 4:68999273-68999295 GGCCATAGTTTGTCAGCCCTTGG + Intergenic
974998106 4:69187462-69187484 GGCCATAGTTTGTCAGCCCTTGG + Intronic
975016829 4:69431916-69431938 GGCCATAGTTTGTCAGCCCTTGG - Intergenic
979647888 4:123093250-123093272 GCCCACACCTTGCCAACTCTGGG - Intronic
992584119 5:78216061-78216083 GGACACAGTTTGTCAGCCCTTGG - Exonic
994358538 5:98823467-98823489 GGCCATAGTTTGTCAACTCCTGG - Intergenic
996548603 5:124707118-124707140 GGGGACAGCTTTTCATCACTGGG + Intronic
997197895 5:131991781-131991803 GGCCAGAGCCTGCCACCTCTTGG + Intronic
997631241 5:135370258-135370280 GCCCACAGCTTTTCACCTCAGGG - Intronic
998329485 5:141311632-141311654 GGCCTCAGTTTGTCACCACTTGG + Intergenic
998811282 5:145968856-145968878 GGACACAGGTTGTCTTCACTAGG + Intronic
999250482 5:150179633-150179655 GACCACTGCCTGTCATCCCTAGG + Intronic
1000062915 5:157672125-157672147 GGCCACATGTTGTCATGCCTGGG - Intronic
1000969151 5:167694696-167694718 GGCCCCAGCTCTTAATCTCTTGG + Intronic
1001332622 5:170773031-170773053 GGCCAAAGATTGTCCTCTCTGGG - Intronic
1003206588 6:4018547-4018569 AGCCAGAGCGTCTCATCTCTGGG - Intergenic
1004084043 6:12426651-12426673 GTCCCCTGCTTGTCATCTCATGG - Intergenic
1004759107 6:18646449-18646471 GGCCCCAGCTTCCTATCTCTGGG - Intergenic
1005490277 6:26341703-26341725 GCCCTCAGCTTGCCATCTATAGG + Intergenic
1006306621 6:33224975-33224997 TGCCACCACTTGTAATCTCTTGG - Intergenic
1006671536 6:35732286-35732308 GCCCCCAGCCTTTCATCTCTTGG + Intergenic
1009309856 6:62136265-62136287 GGCCACAGTTTGTCCACTCTTGG + Intronic
1009599698 6:65783000-65783022 GGCCACAGCTTTTCTTCTACTGG + Intergenic
1012306352 6:97662923-97662945 ACCCACAGCTTGTGATATCTGGG + Intergenic
1013743945 6:113322354-113322376 AGCCAGATCTTTTCATCTCTGGG + Intergenic
1014726593 6:124978753-124978775 GCCCACAGCTTGGCAAGTCTGGG + Intronic
1016476199 6:144432145-144432167 GGCCACAGCTTGTAAACTATAGG - Intronic
1016671487 6:146714222-146714244 GGCCAGAGCTTATCAACTGTTGG + Intronic
1016732992 6:147446902-147446924 TGCCAAAGCTTGACAGCTCTTGG - Intergenic
1018231937 6:161683426-161683448 GGCAAGAGCTAGGCATCTCTGGG + Intronic
1018636177 6:165861372-165861394 GGACACAGCTTGTCCTCTCGGGG + Intronic
1018903853 6:168064062-168064084 GGCCCCAGCTGGTCCTCACTGGG - Intronic
1020307325 7:6844961-6844983 AGCCAGAGCTGGTCTTCTCTTGG + Intergenic
1023770266 7:43550606-43550628 GGCCACAGCTTGCCTTCCCCAGG - Intronic
1026929386 7:74215455-74215477 GGCCACAGACTGTCACCTCCAGG + Intronic
1028121591 7:87061576-87061598 GGCAGAAGCTTGTCATCTTTAGG + Intergenic
1028798667 7:94935331-94935353 GGCCACATGTTGTCATCATTTGG - Intronic
1031956499 7:127947888-127947910 GCACAATGCTTGTCATCTCTGGG - Intronic
1032324383 7:130913430-130913452 GGTCACTGCGTGTCATCTCGAGG - Intergenic
1032500481 7:132396088-132396110 GACCACAGCTCCTCATCTCTAGG - Intronic
1033659989 7:143396495-143396517 AGCCACAGCTTGTCCTCTATGGG + Exonic
1035430702 7:158818582-158818604 GGTCACAGCTGGGCATCTCTGGG + Intronic
1036083820 8:5590764-5590786 GGCCAAAGCTGGTGATGTCTGGG - Intergenic
1042305282 8:67324675-67324697 TTCAACAGCTTGTAATCTCTTGG - Intronic
1043816004 8:84802338-84802360 GGCCACAGTTTGCAAACTCTTGG + Intronic
1044229584 8:89758340-89758362 GGCCTCACCTCGTCACCTCTAGG + Intronic
1045233165 8:100325459-100325481 GACCACACCTTGTCACCTCTAGG + Intronic
1046203699 8:110960216-110960238 GAACACATGTTGTCATCTCTTGG - Intergenic
1048441158 8:134459963-134459985 GGCCACTCCTTGGCCTCTCTGGG + Intergenic
1048665319 8:136654860-136654882 GTCCACAGCCTGTGATCTCCAGG + Intergenic
1049462521 8:142736677-142736699 GGTCACTGCTTGTCAGCTCAGGG + Exonic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1051818877 9:21141519-21141541 GGCTATAGCTGGTCATCACTAGG + Exonic
1057108037 9:92439510-92439532 GGCCACAGCTTTTCATGAGTTGG + Intronic
1059251803 9:112892488-112892510 GGGCAGCCCTTGTCATCTCTGGG + Intergenic
1059254986 9:112921780-112921802 AGCCACAGCATGTTATCTCAAGG + Intergenic
1060996498 9:127877270-127877292 GGCCACAGCTCTCCCTCTCTGGG + Intronic
1061144355 9:128788473-128788495 GGCCACACCTGGTCAGCTCTGGG + Intronic
1061360219 9:130136829-130136851 GGCCACAGCTGCTCACCTCTCGG + Exonic
1061403497 9:130381342-130381364 GGCCAGAGCCTGGCATCTATGGG - Intronic
1185539143 X:888278-888300 TGGCACAGATTGTCATCGCTTGG - Intergenic
1192374945 X:70549795-70549817 GGCTCCTGCATGTCATCTCTGGG + Intronic
1192592606 X:72373178-72373200 GGCCATAGTTTGTCAACTCCTGG - Intronic
1194130867 X:90080130-90080152 TGCCACAGCGTGTCACCTCTGGG - Intergenic
1196750964 X:119116892-119116914 GGCCACAGCTTGTCATCTCTGGG + Intronic
1199134451 X:144234232-144234254 GGACACTGCTTCTCATATCTAGG + Intergenic
1200105227 X:153708399-153708421 GGCCACAGCATGGAATCTTTTGG - Intronic
1200112194 X:153746645-153746667 GGCCTCAGCATGTCTTGTCTGGG - Intergenic