ID: 1196751413

View in Genome Browser
Species Human (GRCh38)
Location X:119121008-119121030
Sequence GGGGGTGTTGGATACAGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196751413_1196751428 25 Left 1196751413 X:119121008-119121030 CCCTAACTGTATCCAACACCCCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1196751428 X:119121056-119121078 ACGAGCCCTGGTCTCAGCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 235
1196751413_1196751427 13 Left 1196751413 X:119121008-119121030 CCCTAACTGTATCCAACACCCCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1196751427 X:119121044-119121066 CCATGAATGAAGACGAGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 207
1196751413_1196751429 26 Left 1196751413 X:119121008-119121030 CCCTAACTGTATCCAACACCCCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1196751429 X:119121057-119121079 CGAGCCCTGGTCTCAGCCCTGGG 0: 1
1: 0
2: 2
3: 35
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196751413 Original CRISPR GGGGGTGTTGGATACAGTTA GGG (reversed) Intronic
900282761 1:1881849-1881871 CGGGGTGCTGGAGACAGTGAAGG + Intronic
902571899 1:17352343-17352365 GGGCTTGTTGGCTACTGTTAAGG + Intronic
906939104 1:50240116-50240138 GGGGGAGTGGGATGCAGTAAAGG + Intergenic
907270961 1:53290848-53290870 GGGGGTGTTGGAGACCGGGAAGG + Intronic
911258382 1:95658890-95658912 GTGGGTCTTGGTTAGAGTTATGG + Intergenic
913288096 1:117246037-117246059 GGGGGTGATGGATATAATGATGG - Intergenic
913589886 1:120313529-120313551 TGGAGTGTTGGTTTCAGTTACGG + Intergenic
913618299 1:120584837-120584859 TGGAGTGTTGGTTTCAGTTACGG - Intergenic
914571915 1:148925386-148925408 TGGAGTGTTGGTTTCAGTTACGG + Intronic
914600921 1:149204874-149204896 TGGAGTGTTGGTTTCAGTTACGG - Intergenic
916103057 1:161409285-161409307 GGGGCTGTTGGCTTCAGTAAAGG + Intergenic
917509167 1:175655979-175656001 GGGGGTGCTGGATCCAGCCAGGG + Intronic
918196903 1:182231330-182231352 GTGGGTGGAGGATACAGGTAGGG + Intergenic
918237386 1:182593529-182593551 GGGGGTGTTGGTTACTTTTATGG + Intergenic
920505067 1:206509552-206509574 AGGGTTGTTGGATGCAGTAAGGG - Intronic
924014216 1:239702315-239702337 GGGTGTTTTGGATTCAGTTCTGG + Intronic
1069784084 10:70977014-70977036 GGGGGTGCTGGATTCAGAGAGGG + Intergenic
1072798700 10:98376612-98376634 GGGGTTGTTTGTTACATTTAAGG - Intergenic
1075930551 10:126291733-126291755 GGGGGTGATGGATGCAGCTCTGG + Intronic
1077368441 11:2170699-2170721 GGGGGTGTAGGATGCAGCTGGGG + Exonic
1077416360 11:2426069-2426091 GGGGGTCTTGCATAGAGTCAGGG - Intergenic
1080028353 11:27635257-27635279 GGAGGTTTTGGTTACAGTCAGGG - Intergenic
1080318697 11:30980558-30980580 TGTGGTGTTGGATAGAGTTGTGG + Intronic
1082735447 11:56850524-56850546 GGAGGTGATGGATATAATTATGG + Intergenic
1092918561 12:13209981-13210003 GGGGCTGTTGGAGACGGTCAGGG + Intronic
1096818454 12:54216302-54216324 GGGGGCGGGAGATACAGTTAAGG - Intergenic
1098392113 12:69980592-69980614 GGGGTTGTTGGAAACATTTGCGG + Intergenic
1099097112 12:78388487-78388509 GGGGGTATTGTAAATAGTTAGGG + Intergenic
1099758545 12:86888891-86888913 GGAGGTGATGGATACGTTTATGG - Intergenic
1104315549 12:127696828-127696850 GGTGGTGATGGAGACAGTGAAGG + Intergenic
1105635953 13:22215532-22215554 GGGGGTGAGGGTTAGAGTTAGGG + Intergenic
1111969503 13:94896618-94896640 GGAGGTGATGGATAAATTTATGG - Intergenic
1113240979 13:108336631-108336653 GGGGGTGTTGGAGAGAGGTAGGG - Intergenic
1114905803 14:27124624-27124646 GGGGGTGAGGAAGACAGTTAAGG - Intergenic
1119773777 14:77236437-77236459 GGGGGTGGGGGATACTGTAATGG + Intronic
1122667353 14:103340578-103340600 GAGGGTATTGGATACAGTGCTGG + Intronic
1125363798 15:38892030-38892052 GGGGGTGGTGGTTAGAGTTTGGG - Intergenic
1127069696 15:55276868-55276890 GGAGGTGATGGATACATTTATGG + Intronic
1137529497 16:49269153-49269175 AGGGGTGTTGAATTCAGGTATGG - Intergenic
1138623562 16:58231281-58231303 GGGGGTGGTGGTGACAGTGAAGG + Intronic
1147026057 17:37584798-37584820 GAGGGTTTAGGATACAGTGAGGG - Intronic
1148569752 17:48658833-48658855 GAGAGAGTTGGATGCAGTTAAGG + Intergenic
1150727089 17:67660183-67660205 GGAGGTGATGGATAGATTTATGG - Intronic
1151243950 17:72779924-72779946 GGGGGTGTGGATTACAGATAGGG - Intronic
1158896856 18:61922213-61922235 GGGGGTGATGGAGACAGTGCCGG - Intergenic
1160078546 18:75702098-75702120 GAGGGTGTTGGAGACAGAGAAGG + Intergenic
1163821256 19:19497819-19497841 GGGGCTGGTGGAGACAGTCAAGG + Intronic
1165170038 19:33885828-33885850 GGAGGTGATGGATATATTTATGG - Intergenic
925136044 2:1525443-1525465 GGGGGTGTTGCAAACAGTGGGGG - Intronic
925139066 2:1537561-1537583 GGGGGTGTTGAACACAGTTGGGG - Intronic
929139698 2:38656085-38656107 GGGGGTGTCAGATACACTTCAGG - Intergenic
939546048 2:143554381-143554403 GGGGGTTTTGGAGAGAGTTTTGG - Intronic
941803677 2:169688494-169688516 AGGTGAGTTGGATACTGTTAAGG - Intronic
943173968 2:184444513-184444535 GTGGGGGTTGGATACAGCTGGGG - Intergenic
947817775 2:233049360-233049382 GGAGGTGCTGGATCCAGGTATGG + Intergenic
1170678324 20:18502670-18502692 GGGGATGATGGATTCAGTTTAGG + Intergenic
1170901632 20:20468915-20468937 GGAGGTGATGGAAACATTTAAGG - Intronic
1174204075 20:48827036-48827058 GGTGGGGGTGGATGCAGTTAGGG + Intronic
949397602 3:3631521-3631543 AGGGCTGTGGAATACAGTTAGGG - Intergenic
953099866 3:39813282-39813304 GGGGATGTTGTATCCAGATATGG + Intronic
956015930 3:64882473-64882495 GGGTGTGTGGAATAGAGTTAAGG + Intergenic
956703105 3:71976289-71976311 GGGGCTGTTGCATACAGTGGAGG + Intergenic
963829366 3:149990533-149990555 GTGGGGGTTGGACACAGCTATGG - Intronic
969642887 4:8409731-8409753 GGGGCTGTGGGATACACTTTGGG + Intronic
973645800 4:52950321-52950343 GGTGGTGTTGAATGCAGTTGGGG + Intronic
981623811 4:146734554-146734576 GGGGGTGTGGGAGACAGTCTTGG + Intronic
985322782 4:188733463-188733485 GGGGGAAATGGATACAGGTAGGG + Intergenic
988911048 5:35844592-35844614 GTGTGTGTTTGATACAGTCATGG - Intergenic
990452579 5:55949852-55949874 GGGGGTGGGGGTTACAATTATGG + Intronic
1000194360 5:158943510-158943532 GGGAGATTTGGATCCAGTTATGG - Intronic
1002864893 6:1112696-1112718 GGAGGTGATGGATATATTTACGG - Intergenic
1004277763 6:14253503-14253525 GGGGGTGGTGAAAACAGGTAGGG + Intergenic
1006389713 6:33751233-33751255 CTGGGTGTTGGATCCAGTTCAGG + Intergenic
1007777067 6:44229827-44229849 GGGGGTGCAGGACACAGTGAGGG - Intronic
1016833484 6:148455055-148455077 GGAGGTGTTGGATACAAGGAGGG + Intronic
1018212316 6:161494271-161494293 GCAGGTGTTGGATAGAGTTGGGG - Intronic
1022901991 7:34820167-34820189 GGAGGTGATGGATACATTTATGG + Intronic
1027817331 7:82992592-82992614 GGGGGTGTGGGATAAAGGGAAGG + Intronic
1029630260 7:101745837-101745859 GGGGGAGTGGGAGACAATTATGG + Intergenic
1029847563 7:103428467-103428489 GGAGGTGATGGATATATTTATGG - Intronic
1031490114 7:122376756-122376778 GGAGGTGATGGATACGTTTATGG + Intronic
1033126419 7:138711108-138711130 GGGGGTGTGGGAAACAGCTGAGG - Intronic
1038906396 8:31908533-31908555 GGAGGTGATGGATACAATTTTGG - Intronic
1041599492 8:59699602-59699624 GAGGGTTCTGGATACAGTTTAGG - Intergenic
1041974654 8:63783484-63783506 GGGGATGGGGGATACAGTAAAGG + Intergenic
1044451581 8:92341963-92341985 GGAGGTGATGAATACAGTGAAGG - Intergenic
1045047233 8:98291180-98291202 TGGGGTCTTGGATATAGTCATGG - Intronic
1047280357 8:123440008-123440030 GGGTATGTTGGATTTAGTTATGG + Intronic
1049369397 8:142256494-142256516 GGTGGTGATGGTTACAGTGATGG - Intronic
1052121426 9:24722317-24722339 GAGTGTGTTGGATAAAGTCATGG + Intergenic
1053536321 9:38930124-38930146 GGAGGTGATGGATATATTTATGG - Intergenic
1054474664 9:65564242-65564264 GTGGGTGTTGGACACAGTGTTGG + Intergenic
1054629813 9:67433824-67433846 GGAGGTGATGGATATATTTATGG + Intergenic
1056578489 9:87873206-87873228 GGAGGGGGTGGACACAGTTAGGG + Intergenic
1056599704 9:88036996-88037018 GGTGGTGTTGGATCCTGTTGGGG + Intergenic
1058416917 9:104798627-104798649 AGGGGTCTTTGATGCAGTTAGGG + Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1061786593 9:133032343-133032365 AGGGGTGTGGGTTACAGTGACGG + Intronic
1061908286 9:133709914-133709936 GGGGGTGATGGAGCCAGTGAAGG + Intronic
1192366077 X:70474477-70474499 GGGGGTGTCGTTTACAGTAATGG + Intronic
1194358191 X:92914993-92915015 GGGGGTGGGGGATGAAGTTAAGG - Intergenic
1196156952 X:112440561-112440583 GAGGGTGTTGGATACAAAAATGG + Intergenic
1196567298 X:117223876-117223898 GGAGGTGATGGATATATTTATGG - Intergenic
1196751413 X:119121008-119121030 GGGGGTGTTGGATACAGTTAGGG - Intronic
1198095653 X:133377353-133377375 GTGGGTGTTGGGTACACTTAAGG - Intronic
1200666369 Y:6030647-6030669 GGGGGTGGGGGATGAAGTTAAGG - Intergenic