ID: 1196755830

View in Genome Browser
Species Human (GRCh38)
Location X:119156302-119156324
Sequence TATGCCACCCCCATTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196755820_1196755830 14 Left 1196755820 X:119156265-119156287 CCTCAACATCAGCCAAGGGAGCA No data
Right 1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG No data
1196755819_1196755830 15 Left 1196755819 X:119156264-119156286 CCCTCAACATCAGCCAAGGGAGC No data
Right 1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG No data
1196755823_1196755830 2 Left 1196755823 X:119156277-119156299 CCAAGGGAGCAAGGGCCCAGCCA No data
Right 1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG No data
1196755815_1196755830 19 Left 1196755815 X:119156260-119156282 CCTCCCCTCAACATCAGCCAAGG No data
Right 1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG No data
1196755813_1196755830 21 Left 1196755813 X:119156258-119156280 CCCCTCCCCTCAACATCAGCCAA No data
Right 1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG No data
1196755814_1196755830 20 Left 1196755814 X:119156259-119156281 CCCTCCCCTCAACATCAGCCAAG No data
Right 1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG No data
1196755818_1196755830 16 Left 1196755818 X:119156263-119156285 CCCCTCAACATCAGCCAAGGGAG No data
Right 1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196755830 Original CRISPR TATGCCACCCCCATTGGAGG AGG Intergenic
No off target data available for this crispr