ID: 1196762212

View in Genome Browser
Species Human (GRCh38)
Location X:119210305-119210327
Sequence GCATTCACAAACTTTGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196762209_1196762212 10 Left 1196762209 X:119210272-119210294 CCACCAGAGCAGCTAGATAGAGT No data
Right 1196762212 X:119210305-119210327 GCATTCACAAACTTTGAGCTAGG No data
1196762208_1196762212 11 Left 1196762208 X:119210271-119210293 CCCACCAGAGCAGCTAGATAGAG 0: 11
1: 635
2: 866
3: 890
4: 1085
Right 1196762212 X:119210305-119210327 GCATTCACAAACTTTGAGCTAGG No data
1196762206_1196762212 18 Left 1196762206 X:119210264-119210286 CCAAGGCCCCACCAGAGCAGCTA 0: 549
1: 474
2: 577
3: 740
4: 1098
Right 1196762212 X:119210305-119210327 GCATTCACAAACTTTGAGCTAGG No data
1196762207_1196762212 12 Left 1196762207 X:119210270-119210292 CCCCACCAGAGCAGCTAGATAGA 0: 16
1: 756
2: 873
3: 908
4: 1129
Right 1196762212 X:119210305-119210327 GCATTCACAAACTTTGAGCTAGG No data
1196762210_1196762212 7 Left 1196762210 X:119210275-119210297 CCAGAGCAGCTAGATAGAGTGTC No data
Right 1196762212 X:119210305-119210327 GCATTCACAAACTTTGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196762212 Original CRISPR GCATTCACAAACTTTGAGCT AGG Intergenic
No off target data available for this crispr