ID: 1196764749

View in Genome Browser
Species Human (GRCh38)
Location X:119233020-119233042
Sequence ACACCTCTGTGTCCCCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196764749_1196764751 -6 Left 1196764749 X:119233020-119233042 CCTCCAAGGGGACACAGAGGTGT No data
Right 1196764751 X:119233037-119233059 AGGTGTAGCAGAAGAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196764749 Original CRISPR ACACCTCTGTGTCCCCTTGG AGG (reversed) Intergenic