ID: 1196764975

View in Genome Browser
Species Human (GRCh38)
Location X:119235390-119235412
Sequence GCTGGAGCCCAGACAAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196764975_1196764981 1 Left 1196764975 X:119235390-119235412 CCCGCCTTTGTCTGGGCTCCAGC No data
Right 1196764981 X:119235414-119235436 CAGGGTTATTGTGACTGCCAAGG No data
1196764975_1196764982 2 Left 1196764975 X:119235390-119235412 CCCGCCTTTGTCTGGGCTCCAGC No data
Right 1196764982 X:119235415-119235437 AGGGTTATTGTGACTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196764975 Original CRISPR GCTGGAGCCCAGACAAAGGC GGG (reversed) Intergenic
No off target data available for this crispr