ID: 1196764981

View in Genome Browser
Species Human (GRCh38)
Location X:119235414-119235436
Sequence CAGGGTTATTGTGACTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196764970_1196764981 20 Left 1196764970 X:119235371-119235393 CCTAGGATCCTTCCAAACTCCCG No data
Right 1196764981 X:119235414-119235436 CAGGGTTATTGTGACTGCCAAGG No data
1196764976_1196764981 0 Left 1196764976 X:119235391-119235413 CCGCCTTTGTCTGGGCTCCAGCT No data
Right 1196764981 X:119235414-119235436 CAGGGTTATTGTGACTGCCAAGG No data
1196764969_1196764981 25 Left 1196764969 X:119235366-119235388 CCAGGCCTAGGATCCTTCCAAAC No data
Right 1196764981 X:119235414-119235436 CAGGGTTATTGTGACTGCCAAGG No data
1196764977_1196764981 -3 Left 1196764977 X:119235394-119235416 CCTTTGTCTGGGCTCCAGCTCAG No data
Right 1196764981 X:119235414-119235436 CAGGGTTATTGTGACTGCCAAGG No data
1196764973_1196764981 8 Left 1196764973 X:119235383-119235405 CCAAACTCCCGCCTTTGTCTGGG No data
Right 1196764981 X:119235414-119235436 CAGGGTTATTGTGACTGCCAAGG No data
1196764971_1196764981 12 Left 1196764971 X:119235379-119235401 CCTTCCAAACTCCCGCCTTTGTC No data
Right 1196764981 X:119235414-119235436 CAGGGTTATTGTGACTGCCAAGG No data
1196764975_1196764981 1 Left 1196764975 X:119235390-119235412 CCCGCCTTTGTCTGGGCTCCAGC No data
Right 1196764981 X:119235414-119235436 CAGGGTTATTGTGACTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196764981 Original CRISPR CAGGGTTATTGTGACTGCCA AGG Intergenic
No off target data available for this crispr