ID: 1196769031

View in Genome Browser
Species Human (GRCh38)
Location X:119274390-119274412
Sequence TTATATCTTTTGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196769028_1196769031 12 Left 1196769028 X:119274355-119274377 CCTGGGTTCAAGGCTCGTCTCTG No data
Right 1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196769031 Original CRISPR TTATATCTTTTGAAAGTGGA AGG Intergenic
No off target data available for this crispr