ID: 1196769799

View in Genome Browser
Species Human (GRCh38)
Location X:119282107-119282129
Sequence AAGAAAATGGAGAGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196769799_1196769807 2 Left 1196769799 X:119282107-119282129 CCGGCCTCCCTCTCCATTTTCTT No data
Right 1196769807 X:119282132-119282154 TTCTCTCACAGGGTGCTGGTTGG No data
1196769799_1196769805 -8 Left 1196769799 X:119282107-119282129 CCGGCCTCCCTCTCCATTTTCTT No data
Right 1196769805 X:119282122-119282144 ATTTTCTTTCTTCTCTCACAGGG No data
1196769799_1196769808 24 Left 1196769799 X:119282107-119282129 CCGGCCTCCCTCTCCATTTTCTT No data
Right 1196769808 X:119282154-119282176 GCTTTTCCTTCACTGTTTCTAGG No data
1196769799_1196769806 -2 Left 1196769799 X:119282107-119282129 CCGGCCTCCCTCTCCATTTTCTT No data
Right 1196769806 X:119282128-119282150 TTTCTTCTCTCACAGGGTGCTGG No data
1196769799_1196769804 -9 Left 1196769799 X:119282107-119282129 CCGGCCTCCCTCTCCATTTTCTT No data
Right 1196769804 X:119282121-119282143 CATTTTCTTTCTTCTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196769799 Original CRISPR AAGAAAATGGAGAGGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr