ID: 1196770573

View in Genome Browser
Species Human (GRCh38)
Location X:119289516-119289538
Sequence CCACGTAAGCTGCTTTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196770573_1196770580 26 Left 1196770573 X:119289516-119289538 CCTGACAAAAGCAGCTTACGTGG No data
Right 1196770580 X:119289565-119289587 AATTTGTTCAAGAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196770573 Original CRISPR CCACGTAAGCTGCTTTTGTC AGG (reversed) Intergenic
No off target data available for this crispr