ID: 1196772518

View in Genome Browser
Species Human (GRCh38)
Location X:119309111-119309133
Sequence CCATCCCTCCGGATCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 20, 1: 71, 2: 130, 3: 138, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196772518_1196772524 -9 Left 1196772518 X:119309111-119309133 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1196772524 X:119309125-119309147 GAGGGATGGAAGTCAGTGGCGGG 0: 32
1: 92
2: 135
3: 160
4: 426
1196772518_1196772528 20 Left 1196772518 X:119309111-119309133 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1196772528 X:119309154-119309176 ACGGCGGCAAACACCAGTGGTGG No data
1196772518_1196772523 -10 Left 1196772518 X:119309111-119309133 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1196772523 X:119309124-119309146 GGAGGGATGGAAGTCAGTGGCGG 0: 15
1: 77
2: 95
3: 156
4: 634
1196772518_1196772526 4 Left 1196772518 X:119309111-119309133 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1196772526 X:119309138-119309160 CAGTGGCGGGTCTGCAACGGCGG No data
1196772518_1196772527 17 Left 1196772518 X:119309111-119309133 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1196772527 X:119309151-119309173 GCAACGGCGGCAAACACCAGTGG No data
1196772518_1196772529 24 Left 1196772518 X:119309111-119309133 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG No data
1196772518_1196772525 1 Left 1196772518 X:119309111-119309133 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1196772525 X:119309135-119309157 AGTCAGTGGCGGGTCTGCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196772518 Original CRISPR CCATCCCTCCGGATCCAGCA GGG (reversed) Intergenic
900123317 1:1058819-1058841 CCATCCCTCCAGACGCATCAGGG - Intergenic
900610006 1:3540677-3540699 CCAGCCCTCTGGATCCTCCAGGG + Intronic
901495545 1:9619329-9619351 CCTTCCCTCCAGCTCCAGAACGG - Intergenic
901647865 1:10726433-10726455 TCCTCCCTCCGGCTCCAGCCAGG - Intronic
903129677 1:21270578-21270600 CCATCCCACTTGATCCTGCAGGG - Intronic
903135529 1:21307107-21307129 CCCTTCCTCTGGGTCCAGCATGG + Intronic
903340683 1:22652495-22652517 CCCTCCCTCTGCTTCCAGCAGGG - Intergenic
903789787 1:25885040-25885062 CCAGCCCTGGGGAACCAGCATGG - Intronic
904397184 1:30229838-30229860 CCACCCCTCCGGATCCGGCAGGG + Intergenic
906065593 1:42978219-42978241 ATAGCCCTCTGGATCCAGCAAGG + Intergenic
906507519 1:46391138-46391160 CCATCCCTCTGGATCCGGCAGGG - Intergenic
906582997 1:46952052-46952074 CCATCCCTCCAGATCCAGCAGGG + Intergenic
907506066 1:54919098-54919120 CTATCCCTCTGAATCCGGCAGGG - Intergenic
907602957 1:55788499-55788521 CCACCCCTCTGGATACGGCAGGG - Intergenic
908717670 1:67087564-67087586 CCACCCCTCCAGATCTGGCAGGG + Intergenic
908723217 1:67148181-67148203 CCACCCCTCTGGATCCGGCAGGG - Intronic
908892690 1:68863892-68863914 CCACCCCTCTGGATCCGGCTGGG + Intergenic
909859903 1:80592497-80592519 CCATCCCTCCGGATCCAGCAAGG - Intergenic
910116672 1:83739163-83739185 CCATCCCTCTGGATCCGGCAGGG - Intergenic
910590517 1:88924693-88924715 CCATCTCTCCAGATCCGGTAAGG + Intergenic
912285711 1:108366245-108366267 CCATCCCTCCGGATCCAGCAGGG - Intergenic
912463395 1:109852549-109852571 CCGCCCCTCTGGATCCGGCAGGG - Intergenic
913470774 1:119183083-119183105 CCAACCCTCTGGATCTGGCAGGG - Intergenic
914319985 1:146549772-146549794 CCTTGTCTCCGGCTCCAGCAGGG + Intergenic
914922418 1:151856464-151856486 CCATCCTTCCAGATCAAGGATGG - Intergenic
917203299 1:172541439-172541461 TCATCCCTTGGGATCCAGAAGGG - Intronic
917413373 1:174783115-174783137 CCAGCCCTCTGGATCCTGCAGGG + Intronic
917982342 1:180278154-180278176 CCATACCTCCCCAGCCAGCAGGG + Exonic
919082771 1:192886750-192886772 CCATACCTCCAGATCCAGCAGGG - Intergenic
919843069 1:201623223-201623245 CAATTCTTCCGGATCCAGCCCGG - Intronic
920639843 1:207741471-207741493 CCATTCCTCCGGATCCGGCAGGG - Intergenic
922007929 1:221551008-221551030 CCATCCCTCCAGATCAGGCAGGG - Intergenic
922683923 1:227624830-227624852 CCATCCCTCTGGATCTGGCAGGG - Intronic
922685150 1:227633115-227633137 CCACCCCTCCGGATCCGGCAGGG - Intronic
922802911 1:228372209-228372231 CCAGCCCTCCGCATCCAGGGAGG - Exonic
922876314 1:228942559-228942581 CCATGCCTCCAGATCAGGCAGGG + Intergenic
922877778 1:228953937-228953959 CCATCCCTCTGGATCTGGCAGGG + Intergenic
1065222790 10:23513330-23513352 TCACCACTCCGGATCCGGCAGGG - Intergenic
1066246829 10:33591917-33591939 CCATCCCTCTGGATCCAGCAGGG - Intergenic
1066673007 10:37859410-37859432 CCATCCCTCCGGATCTGGCAGGG - Intergenic
1068191622 10:53659799-53659821 CCATCCCTCCGGATCCGGCAGGG + Intergenic
1068988840 10:63130968-63130990 CCACCCCTCTGGATCCATCAGGG - Intergenic
1069037957 10:63664953-63664975 CCACCCCTCTGGATCCCGCAGGG - Intergenic
1071051882 10:81460208-81460230 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1071199269 10:83200090-83200112 TCATCCTTCCAGATCCAGGAGGG + Intergenic
1071326717 10:84525687-84525709 CCACCCCTCCGGATCTGGCAGGG - Intergenic
1071327406 10:84530627-84530649 CCACCCCTCTGGATCTGGCAGGG - Intergenic
1071557003 10:86612128-86612150 CCATCCCTCCGGTTCCGGCAGGG + Intergenic
1072378554 10:94841345-94841367 CCATCCCTCCAGATCTGGCAGGG - Intronic
1072472429 10:95724682-95724704 CCACCCCTCTGGATCCAGCAGGG - Intronic
1072650321 10:97290284-97290306 CCATCCCTCCGGATCTGGCAGGG + Intronic
1072795089 10:98348597-98348619 CAATCCCTCCAGATCCCGCAGGG + Intergenic
1072971457 10:100021065-100021087 CCATCACGCCGGCTGCAGCAGGG - Intergenic
1074317913 10:112375921-112375943 CCTGTCCTCCGAATCCAGCAGGG + Intronic
1074978457 10:118599842-118599864 CCACCCCTCTGGATGCAGCAGGG - Intergenic
1076346895 10:129785481-129785503 CCATCCCTCCTGATGCAGCCAGG - Intergenic
1077225440 11:1437348-1437370 CCAGCCCTCAGGAGCCAGCGTGG - Intronic
1077352274 11:2098549-2098571 GCGTCCCCCCGGCTCCAGCAGGG + Intergenic
1078191869 11:9097735-9097757 CCACCCCTCCAGATCCGGCAGGG + Intronic
1079431823 11:20397407-20397429 CCATTGCTTCAGATCCAGCAGGG + Intronic
1079601735 11:22317894-22317916 CCATCCCTCCGGATGCGGCAGGG - Intergenic
1079692850 11:23441426-23441448 CCATCCCTCCAGATCCGCAAGGG + Intergenic
1079884277 11:25966514-25966536 CCATCCCTCAGGATCCAGCAGGG - Intergenic
1079933248 11:26590768-26590790 CCACCCCTCCGGATCCAGCAGGG - Intronic
1079934234 11:26597487-26597509 CAACCCCTCCAGATCCGGCAGGG - Intronic
1080881476 11:36325314-36325336 CCAACCCTCCAGATCCAGCAGGG - Intronic
1081063041 11:38504043-38504065 CCACCCCTCTGGATCCAGCAGGG + Intergenic
1081069731 11:38595818-38595840 CCATCCCTCTGGATCCAGCAGGG - Intergenic
1081070185 11:38602019-38602041 CCACCCCTTTGGATCCAGCAGGG + Intergenic
1081070868 11:38606892-38606914 CCACCACTTTGGATCCAGCAGGG + Intergenic
1082737613 11:56873947-56873969 CCACCCCTCCAGATCCGGCAGGG + Intergenic
1083107009 11:60368087-60368109 CTACCCCTCCGGATCTGGCAGGG + Intronic
1083193349 11:61068331-61068353 CCATCCCTCCCAATCCACCGTGG + Intergenic
1083248284 11:61447234-61447256 CCTTCCCTCCTGAGCCACCAGGG - Exonic
1084878733 11:72154347-72154369 CCACCCCTCCAGATCTGGCAGGG + Intergenic
1085040851 11:73325409-73325431 CCAGCCCGCAGGCTCCAGCAGGG - Intronic
1085041755 11:73330956-73330978 CCAGCCCTCTGGATCCAGGAAGG + Intronic
1085100437 11:73796052-73796074 CCATCACTCTGGCTGCAGCAGGG + Intronic
1085601983 11:77863295-77863317 CCATCCCTCCGGATCCGGCAGGG - Intronic
1085621578 11:78041732-78041754 CCATCCCTCCGGATCTGGCAGGG + Intronic
1085900969 11:80699523-80699545 CCACCCCTCCGGATCCGGCAGGG - Intergenic
1086511201 11:87559874-87559896 CCACCCCTCCAGATCCGGCAGGG - Intergenic
1087901293 11:103644845-103644867 CCACCCCTCCAGATCCGGCAGGG - Intergenic
1088110103 11:106251182-106251204 CTATCCCTCTGGATCTGGCAGGG + Intergenic
1089563417 11:119357254-119357276 CAATCACTCCGGAACCACCATGG - Exonic
1091588917 12:1831540-1831562 CAATCCCTCGGGCCCCAGCAGGG - Intronic
1092293650 12:7181313-7181335 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1093106654 12:15095414-15095436 CCATCCCTCTGGATCCGGCAGGG - Intergenic
1094641006 12:32275705-32275727 CCATCCCTCCAGATCCGGCAGGG + Intronic
1095138584 12:38636667-38636689 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1095283471 12:40384054-40384076 CTACCCCTCCGGATCTGGCAGGG + Intergenic
1095552479 12:43459213-43459235 CCATCCCTCCGGATCCAACAGGG + Intronic
1095893104 12:47253015-47253037 CCATCCCTCCAGATCAGGCAGGG - Intergenic
1096351226 12:50902814-50902836 CCATTCCTCTGGGTCCGGCAGGG - Intergenic
1096352543 12:50912185-50912207 CCATCCCTCTGGATCTGGCAGGG - Intergenic
1096841844 12:54384703-54384725 CCATTGCTCTGGAGCCAGCAGGG - Intronic
1096939400 12:55325703-55325725 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1097376738 12:58852181-58852203 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1097377746 12:58859310-58859332 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1097840854 12:64320005-64320027 CCATCCCTCCGGATCCGGCAGGG + Intronic
1098639871 12:72825590-72825612 CCATCCCTCCCAATCCAGCAGGG - Intergenic
1098984881 12:77001495-77001517 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1099292623 12:80790120-80790142 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1099605041 12:84794138-84794160 CCACCCCTCCGGATCCGGCAGGG + Intergenic
1100205058 12:92339660-92339682 CCATGCCTCTGGATCTGGCAGGG - Intergenic
1101583832 12:106067255-106067277 CCAGCCCCCCGGACCCAGCCAGG - Exonic
1103023507 12:117555283-117555305 TTACCCCTACGGATCCAGCAAGG - Exonic
1103598865 12:122041392-122041414 CCATCGCCCCGGGTGCAGCATGG + Intronic
1103802563 12:123548840-123548862 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1103804004 12:123558425-123558447 CTAGCCGTCCGGATCCGGCAGGG + Intergenic
1103872333 12:124100795-124100817 CCACCCCTCCGGATCCGGCAGGG - Intronic
1103873171 12:124105970-124105992 CCACCCCTCCGGATCCAGCAGGG - Intronic
1104187860 12:126449627-126449649 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1104850959 12:131873517-131873539 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1106620119 13:31364708-31364730 CCATCATTCCGGCTGCAGCAGGG + Intergenic
1107156420 13:37172360-37172382 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1107513416 13:41107203-41107225 CCATCACGCCGGCTGCAGCAGGG + Intergenic
1107700917 13:43046824-43046846 ACACCCCTCTGGATCCAGCAGGG + Intronic
1108876210 13:55054068-55054090 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1108877230 13:55061383-55061405 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1109292824 13:60497120-60497142 CCACCCTTCCGGATCCAGCAGGG - Intronic
1109520622 13:63505539-63505561 CCATCCCTCTGGATCCGGCGGGG - Intergenic
1109523580 13:63545099-63545121 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1109594008 13:64525868-64525890 CCATCCCTCCAGATCCAGTAGGG + Intergenic
1109931305 13:69222058-69222080 CCATCCCTCCGGATCCGGCAGGG + Intergenic
1110660998 13:78059487-78059509 CCACCCCTCCCTATCCAGCAGGG + Intergenic
1110846151 13:80192475-80192497 CCATCCCTCCGGATCTGGCAGGG + Intergenic
1110987069 13:81984397-81984419 CCATCCCTCCAGATCCGGCAGGG - Intergenic
1111021451 13:82457728-82457750 CCATCCCTCCGGATCCGGCAGGG + Intergenic
1111100903 13:83584903-83584925 CCATCCCTCAGGATCCAGCAGGG - Intergenic
1111122965 13:83878972-83878994 CCATCCCTGCGTAGCCAACAGGG + Exonic
1111174777 13:84580084-84580106 CTGTCCCTCCAGATCCGGCAGGG - Intergenic
1111536789 13:89612074-89612096 CCATCCCTCTGGATCCGGCAGGG - Intergenic
1111709772 13:91796316-91796338 CCAACCCTCCAGATCCGGCAGGG - Intronic
1111820405 13:93206939-93206961 CCATCCCTCCGGATCCGGCAGGG + Intergenic
1113534729 13:111056645-111056667 CCATCTCTCCAGATCCGGCAGGG + Intergenic
1113686606 13:112286190-112286212 CAATCCCTCAGGATGGAGCAAGG + Intergenic
1114383856 14:22236779-22236801 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1114384832 14:22243826-22243848 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1114840848 14:26260628-26260650 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1115151668 14:30293310-30293332 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1115757569 14:36544474-36544496 CTATCCCTCCGGATCCGGCAGGG - Intergenic
1116118798 14:40694709-40694731 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1116740335 14:48746746-48746768 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1117171818 14:53108171-53108193 CCATCCCTCCGGATCCGGCAGGG + Intronic
1117982056 14:61351353-61351375 CCATCTCTCAGGCTCCAGGAAGG - Intronic
1118453508 14:65925210-65925232 CCAACCCTCCGGATCCGGCAGGG - Intergenic
1119089934 14:71772170-71772192 CCATCCCTCCAGATCTGGCAGGG - Intergenic
1119396112 14:74327447-74327469 CCATCCCTGCGGATCAGGAAAGG - Intronic
1120097385 14:80403906-80403928 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1120107977 14:80517931-80517953 CCACCCCTCTGGATCTGGCAGGG - Intronic
1120341443 14:83225741-83225763 CCATCCCTCTGAATCCGCCAGGG + Intergenic
1120397392 14:83985627-83985649 CCATCCCTCTGGATCCGGCAGGG + Intergenic
1120421169 14:84287725-84287747 CCATCCCTTCGGTTCCCGTAAGG + Intergenic
1121378701 14:93440267-93440289 TCATCCCTCAGTATCCACCAGGG - Intronic
1122001013 14:98653555-98653577 CCATCCTTCCAGATCCAGCAGGG + Intergenic
1122243604 14:100384807-100384829 CCCTCCTTCCTGATCCAGCAGGG - Intronic
1123020190 14:105394364-105394386 GCGTCCCTCAGGAGCCAGCATGG + Intronic
1123125468 14:105942912-105942934 CCATCCCTCCGGATCCATCAGGG + Intergenic
1123987301 15:25657076-25657098 CCACCCCTCCGGATCCGGCAGGG + Intergenic
1124012405 15:25849330-25849352 CTGTCCCTCCGGAGGCAGCAAGG + Intronic
1125630641 15:41144206-41144228 CCACCGCTCCCGGTCCAGCAGGG + Intergenic
1126153880 15:45547348-45547370 CCCCCCCTCCAGATCCGGCAGGG - Intergenic
1126687466 15:51261013-51261035 CCACCTCTCCGGATCCAGCAGGG + Intronic
1126728333 15:51655589-51655611 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1127074510 15:55312190-55312212 CCATCCCTCCGGATCCAGCAGGG - Intronic
1128363103 15:66976437-66976459 CCACCCCTCCGGATCCAGCAGGG - Intergenic
1129312800 15:74724484-74724506 TCTTCCCTCTGGATCCAGCTGGG - Intronic
1129776369 15:78239282-78239304 CCATCCGTCTGGATCCGGCAGGG - Intronic
1130224890 15:82048681-82048703 CCTGCCTTCAGGATCCAGCAGGG - Intergenic
1130825964 15:87546647-87546669 CTGTCCCTCTGGATCCGGCAGGG - Intergenic
1131420118 15:92298312-92298334 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1131673855 15:94651185-94651207 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1133212273 16:4270373-4270395 CCATCCCTCAGTGACCAGCAGGG - Intronic
1135064266 16:19296141-19296163 CCATCCCTCCTGATCAATCCTGG - Intronic
1135992868 16:27228496-27228518 CCTCCCCTCCAGATCCATCACGG + Intronic
1135992907 16:27228608-27228630 CCTCCCCTCCAGATCCATCATGG + Intronic
1135992945 16:27228720-27228742 CCTCCCCTCCAGATCCATCATGG + Intronic
1135992961 16:27228776-27228798 CCTCCCCTCCAGATCCATCATGG + Intronic
1136223262 16:28842566-28842588 CTATCGCTCTGGAGCCAGCATGG - Exonic
1138767156 16:59618087-59618109 CAATCCCTCCAGGGCCAGCAAGG + Intergenic
1140013541 16:71160305-71160327 CCTTGTCTCCGGCTCCAGCAGGG - Intronic
1141298463 16:82791642-82791664 CCACCCCTCTGGATCCAGCAGGG + Intronic
1141761402 16:86030996-86031018 CCATCTCTCTGGCTCCAGCTGGG + Intergenic
1142278310 16:89134452-89134474 CTATTCCTCCGGATCCCGCAGGG - Intronic
1143724727 17:8837201-8837223 CCAGCCCTCCTGCTCCATCAGGG + Intronic
1147553866 17:41464033-41464055 CCATCCCTCCGGATCCTAGGCGG - Intronic
1148371985 17:47106714-47106736 CCATTCCTCCGGATCCAGCAGGG - Intergenic
1148826722 17:50399280-50399302 CCACCCCTCTGGATCTGGCAGGG - Intergenic
1149243102 17:54673728-54673750 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1150322200 17:64224621-64224643 CCATCTCTTCCGACCCAGCAGGG + Intronic
1151017855 17:70577632-70577654 CCACACCCCCGGATCCGGCAGGG + Intergenic
1151154329 17:72114231-72114253 CCATCCTTGCGGCTCCATCAAGG - Intergenic
1151224453 17:72638395-72638417 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1153402064 18:4692050-4692072 CCATCCCTTCGGATCCGGCAGGG + Intergenic
1153617632 18:6949152-6949174 CAAACCCTCCACATCCAGCATGG + Exonic
1153991347 18:10403421-10403443 CCTTCCCTCGGGATCCACCAAGG - Intergenic
1155273820 18:24166999-24167021 CCAGCCCTCCAGACCCAGCAAGG - Intronic
1155749232 18:29399194-29399216 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1157782196 18:50449467-50449489 CCATCCCTTCGGATTCGGCAGGG - Intergenic
1157934139 18:51855341-51855363 CCATACCTCCTGAAGCAGCAGGG + Intergenic
1159276127 18:66223482-66223504 CCATCCCTCCAGAACCGGCAGGG + Intergenic
1159279771 18:66270430-66270452 CCATCCCTCCAGATCCAACAGGG - Intergenic
1160102762 18:75938496-75938518 CTGTCCCTCCAGATCCAACAGGG - Intergenic
1163901140 19:20101128-20101150 CTCCCCCTCCGGATCCAGCAGGG + Intronic
1164056878 19:21629520-21629542 TCATCCCTCCAGATCCAGCAAGG + Intergenic
1164173177 19:22745567-22745589 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1164976391 19:32575863-32575885 CCATCCCTCCAGGGTCAGCAAGG - Intergenic
1165823202 19:38690311-38690333 CCACCCCTCCGGATCCAGCAGGG + Intronic
1166165570 19:40985928-40985950 CCACCCGTCCGGATCCAGCATGG + Intergenic
1166165659 19:40986579-40986601 CCACCCCTCCAGATCCAGCATGG - Intergenic
1166676702 19:44745558-44745580 GCGTGCCTCCGGAGCCAGCAGGG - Intergenic
1167462182 19:49631314-49631336 CCACCACTCCCCATCCAGCAGGG + Intergenic
1167523818 19:49971867-49971889 ACATCCCTCCGGGTCCTGGAGGG + Intergenic
1167564988 19:50250537-50250559 CCAGCACTCCTCATCCAGCAGGG - Exonic
1168115923 19:54221343-54221365 CCCTCCCTCCTGACCCTGCAGGG - Exonic
1168118906 19:54241091-54241113 CCCTCCCTCCTGACCCTGCAGGG - Exonic
1168121721 19:54255546-54255568 CCCTCCCTCCTGATCCCGCAGGG - Exonic
1168129776 19:54310834-54310856 CCCTCCCTCCTGACCCCGCAGGG - Intronic
1168133849 19:54337660-54337682 CCCTCCCTCCTGACCCTGCAGGG - Exonic
1168147008 19:54425202-54425224 TCCACCCTCCGGATCCGGCAGGG - Intronic
1168187537 19:54709569-54709591 CCCTCCCTCCTGACCCTGCAGGG + Intergenic
1168342685 19:55634813-55634835 CCCTCCCTCAGCATCCGGCACGG + Intergenic
924973613 2:153855-153877 CCACCCCTCCGGATCCAACAGGG - Intergenic
924974500 2:160339-160361 CCACCCCTCCGGATCTGACAGGG - Intergenic
925023818 2:592630-592652 CCATCTCTCCAGAGCCGGCAGGG + Intergenic
926864991 2:17346356-17346378 CCATTCTTCTGGATCCAGCAGGG + Intergenic
926984535 2:18607816-18607838 CCATCACTCTAGTTCCAGCAGGG - Intergenic
928319130 2:30269307-30269329 CCATCCCTCTGGATCTAGCAGGG + Intronic
928440109 2:31285137-31285159 CCACCCCTCCGGATCCAGCAGGG + Intergenic
928671898 2:33610985-33611007 CCACCCCTCCGGATCCAGCAGGG - Intergenic
928676638 2:33657588-33657610 TCACCCCTCCGGATCTGGCAGGG + Intergenic
928773660 2:34732738-34732760 CCATCCCTCTGGATCCAGCAGGG - Intergenic
930485723 2:52008256-52008278 CCACCCCTCCAGATCTGGCAGGG + Intergenic
931038987 2:58275797-58275819 CCATCCGTCCAGATCCGGCAAGG + Intergenic
932374775 2:71226496-71226518 CAATCCCTCCCGCTCCAGCCCGG + Intronic
932460517 2:71879171-71879193 CCTTCCCTCTGGCTCCATCATGG + Intergenic
932917183 2:75872100-75872122 CTATCCCTCCGGATCCGGCAGGG + Intergenic
932918187 2:75879138-75879160 CTATCCCTCCGGATCCGTCAGGG + Intergenic
933121763 2:78547002-78547024 CCACCCCTCTGGATCTGGCAGGG - Intergenic
933175726 2:79170171-79170193 CCATCCCTCAGGATCCAGCAGGG - Intergenic
933328837 2:80871734-80871756 CCATCCCTCTGGATCCAGCAGGG + Intergenic
933328844 2:80871762-80871784 CCTGCGCTCCTGATCCAGCAAGG + Intergenic
933461483 2:82592519-82592541 CCATCCCTCCAGATCTAACTTGG - Intergenic
933500212 2:83101811-83101833 CCATCCCTCCGGATCCAGCAGGG + Intergenic
934567170 2:95347243-95347265 CCAACCCTCCGGAGCCGGGAGGG - Intronic
934672426 2:96223136-96223158 CCACCCCTCCAGATCCAGCAGGG - Intergenic
935292868 2:101624836-101624858 CCCTCCCTCCAGATTCCGCAAGG + Intergenic
935748355 2:106209374-106209396 CCACCCCTCCGGATCCAGCAGGG + Intergenic
936086817 2:109474865-109474887 GCAACCCTCCAGAGCCAGCAGGG + Intronic
937328346 2:121005750-121005772 CCTTCCCTCCTGTTCCAGTAGGG - Intergenic
937466161 2:122134940-122134962 GCATCCCTAGGGAGCCAGCAAGG + Intergenic
937594977 2:123661615-123661637 CCACCCCTCCAGATCTGGCAGGG + Intergenic
937636235 2:124158279-124158301 CCATCCCTCTGTATCCATGAAGG + Intronic
939134078 2:138273473-138273495 CCATCCCTCTGGATCCAGCAGGG - Intergenic
939824471 2:146998547-146998569 CTATCCCTCCGGATCCGGCAGGG + Intergenic
942580686 2:177412964-177412986 CCACCCCTCCAGATCCAGCAGGG - Intronic
942679495 2:178462582-178462604 CCATCCCTCTGAATCTGGCAGGG + Intergenic
943019263 2:182552947-182552969 CCATCCCTCCAGATCCAGCAGGG + Intergenic
943184054 2:184582760-184582782 TCATCCCTCAGGATCTAACAAGG - Intergenic
943462360 2:188184642-188184664 CCATGCCTCCGGATCTGGCAGGG - Intergenic
944039784 2:195339894-195339916 CCACCCCTCCGGATCTGGCAGGG - Intergenic
945064780 2:205939588-205939610 CCATCCCTCCGGATCCAGCAGGG + Intergenic
945395006 2:209306632-209306654 CCATCCCTCCGGATCCAGCAGGG + Intergenic
945999676 2:216470978-216471000 CCATCTCTCTGGGGCCAGCATGG - Intronic
946488518 2:220124948-220124970 CCATTACCCCGGATGCAGCATGG - Intergenic
947327461 2:228993295-228993317 CCATCACTCTGGCTGCAGCAGGG - Intronic
948517652 2:238514244-238514266 CCACCCCTCTGGATCCGGCAGGG + Intergenic
1169340836 20:4795182-4795204 CCATCCCTCCTTATCCTCCATGG - Intronic
1171223234 20:23420560-23420582 CCACCCCTCCGGCTCCACCCCGG + Intronic
1171500785 20:25591446-25591468 CCATCCCTCCGGATCTGGCAGGG - Intergenic
1172947204 20:38698791-38698813 CCACCCCTCTGGATCAGGCAGGG + Intergenic
1173276255 20:41586286-41586308 TCACCCCTCCGGATCCGGCAGGG + Intronic
1173450843 20:43162632-43162654 CCATCACTCTGGAGGCAGCAAGG + Intronic
1176190035 20:63804175-63804197 GCATCCCTCCAGCTCCAGCCAGG + Intronic
1177263969 21:18760106-18760128 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1177359352 21:20048603-20048625 CCACCCCTCCGGATCCGGCACGG - Intergenic
1177426362 21:20927710-20927732 CCACCACTCCAGATCCGGCAGGG + Intergenic
1177531186 21:22360103-22360125 CCATCCCTCCAGATCTGGAAGGG - Intergenic
1177624124 21:23636797-23636819 CTATCCATTCGCATCCAGCAAGG - Intergenic
1177738133 21:25118822-25118844 CCACCCCTCCGGATCCGGCAGGG + Intergenic
1177895740 21:26854857-26854879 CCATCCCTCTAGATCTGGCAGGG + Intergenic
1177896712 21:26861691-26861713 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1180114212 21:45686288-45686310 GCATCCCTCCTGAACCACCAAGG + Intronic
1182221368 22:28761591-28761613 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1185121794 22:48975671-48975693 CGTTCCCTCCGCCTCCAGCAAGG + Intergenic
951016250 3:17735764-17735786 CCACCCCTCCAGATCCAGCAGGG - Intronic
951201165 3:19876427-19876449 CCATCCCTCTGAATCTGGCAGGG - Intergenic
951326066 3:21303088-21303110 CCATCCCTCCAGATCCGGCAGGG - Intergenic
951837652 3:27001182-27001204 CCATCCCTCCAGATCTGGCAGGG + Intergenic
952921707 3:38289735-38289757 CCACCCCTCCGGATCTGGCAGGG - Intronic
952922689 3:38296882-38296904 CCACCCCTCCGAATCTGGCAGGG - Intronic
953505903 3:43485307-43485329 CCATACCTCCGGATCCGACAGGG + Intronic
953515831 3:43591234-43591256 CCATCCCTCCAGATCAGGCAGGG + Intronic
955227623 3:57074019-57074041 CCAGCTCTCCTGATACAGCAAGG + Exonic
955381268 3:58440177-58440199 CCACCCCTCTGGATCCGGCAGGG - Intergenic
956564250 3:70617529-70617551 CCATCCCTCCAGATCTGGCAGGG + Intergenic
957000498 3:74877898-74877920 CCATCCCTCCGGATCCGGCAGGG - Intergenic
957296903 3:78344224-78344246 CCATCCCTCTAGATCCAGCAGGG - Intergenic
957687051 3:83515334-83515356 CCATCCCTCCGGATGCGGCAGGG + Intergenic
957895115 3:86412003-86412025 CCACCCTTCTGGATCCGGCAGGG + Intergenic
958016738 3:87946192-87946214 CCACCCCTCTGGATCCGGCAGGG - Intergenic
958091887 3:88886793-88886815 CCACCCCTCTGGATCCGGCAGGG - Intergenic
958424512 3:93965317-93965339 CCATCCCTCCGGATCCGGAAGGG + Intronic
958457043 3:94345271-94345293 CCACCGCTCCGGATCCGACAGGG - Intergenic
958629239 3:96666787-96666809 CCATCCCTCTGGATCCGGCAGGG - Intergenic
958630361 3:96675005-96675027 ACATCCCTCCGGATCTGGCAGGG - Intergenic
959161766 3:102732773-102732795 CCATCCCTCCGGATCCAGCAGGG - Intergenic
959406350 3:105966208-105966230 CCACCCTTCCAGATCCGGCAGGG + Intergenic
959450007 3:106487159-106487181 CCATTCTTCCGGATCCAGCAGGG - Intergenic
960006973 3:112790701-112790723 CCTGCGCTCCTGATCCAGCAAGG - Intronic
960006982 3:112790730-112790752 CCACCCCTCCAGATGCAGCAGGG - Intronic
961426433 3:126851973-126851995 CCCTCCCTCCAGATCCAGTTAGG - Intronic
963255688 3:143142531-143142553 CCACCCCTCCGGATCCGGCAAGG + Intergenic
963492277 3:146016781-146016803 CCATTCTTCCGCATCCGGCAGGG + Intergenic
963575893 3:147060196-147060218 CCATCCCTCCAGATCTGGCAGGG + Intergenic
963589058 3:147233629-147233651 CGCTCCCCCAGGATCCAGCAAGG + Intergenic
963915319 3:150854417-150854439 CCATCCCTCTGGATCTGGCAGGG + Intergenic
965342125 3:167503663-167503685 CCATCCCTCTGGATCTGGCAGGG - Intronic
966353276 3:179054765-179054787 CCATGCCTCCGGATCCAGCAGGG + Intronic
966511216 3:180765629-180765651 TCACCCCTCCGGATCCGGCAGGG - Intronic
966994315 3:185265059-185265081 CCACCCCTCCGGATCCGGCAGGG + Intronic
967389154 3:188938539-188938561 CCATCCCCCTGGATCCCGCAGGG - Intergenic
967623107 3:191658955-191658977 CCATCCCTCCGCATCCAGCAGGG + Intergenic
968390866 4:192099-192121 CCAACCTTCTGGATCCAGCAGGG - Intergenic
969162624 4:5274841-5274863 TCATCCCTCCAGATCCAGCAGGG + Intronic
969292484 4:6248881-6248903 CCATGCCTCCTGTCCCAGCAGGG - Intergenic
969540364 4:7784705-7784727 CCATCCCTCAGGAGCCACGATGG - Intronic
969644669 4:8420789-8420811 CCACCCCTCCGGATCCAGCAGGG + Intronic
969645662 4:8427448-8427470 ACCCCCCTCCAGATCCAGCAGGG + Intronic
970095535 4:12459592-12459614 CCATCCCTGCGGATCCGGCAGGG + Intergenic
970155090 4:13133633-13133655 CCACCTCTCTGGCTCCAGCAGGG - Intergenic
970738106 4:19198095-19198117 CCATCCCTCTGGATCCAGCAGGG - Intergenic
971076785 4:23158421-23158443 CCACCCTTCCGGATCTGGCAGGG + Intergenic
971980357 4:33742991-33743013 CCATTCTTCTCGATCCAGCAGGG + Intergenic
972766764 4:42158524-42158546 CCATCCCTCTGGATCTGGCAGGG - Intergenic
972781771 4:42292454-42292476 CCACCCCTGCGGATCTGGCAGGG - Intergenic
972853848 4:43082264-43082286 CCATCCCTCCAGATCTGGCAGGG + Intergenic
973205062 4:47550804-47550826 CCACCCCTGCGGATCTGGCAGGG - Intronic
973245870 4:48010793-48010815 CCATCCCTCTGGATCCGGCAAGG - Intronic
974258413 4:59492152-59492174 CCATCACTCCAGCTGCAGCAGGG - Intergenic
974487288 4:62522475-62522497 CTACCCCTCCGGATCCAGCAGGG + Intergenic
974487843 4:62526851-62526873 CCATCCCTCTGGATCTGGCAGGG - Intergenic
974519967 4:62971439-62971461 CCAGCCCTCCGGATCCGGCAGGG + Intergenic
974520768 4:62977424-62977446 CCACCCCTCCAGATCCAGCAGGG + Intergenic
974648491 4:64724938-64724960 CCACCCCTCTGGATCCAGCAGGG - Intergenic
974841803 4:67307641-67307663 CCACCTCTCCAGATCCGGCAGGG + Intergenic
975313219 4:72925981-72926003 CCATCCCTCTGGATCCGGCAGGG - Intergenic
975314184 4:72932743-72932765 CCATCCCTCCGGATCTGGCAGGG - Intergenic
975418812 4:74138632-74138654 CCACTCCTCCGGATCCAGCAGGG - Intronic
976189296 4:82473738-82473760 CCACCCCTCCGGATCCAGCAGGG + Intergenic
976464843 4:85355197-85355219 CCACCCCTCCGGATCTGGCAGGG - Intergenic
977251328 4:94692671-94692693 CCACCCCTCTGGATCCGGTAGGG + Intergenic
977342096 4:95771781-95771803 CCACTCCTCCAGATCCAGCAGGG + Intergenic
977556184 4:98489624-98489646 CCACCCCTCCGGATCCGGCAGGG + Intronic
977618431 4:99109773-99109795 CCACCACTCCAGATCCAGCAGGG - Intergenic
978527666 4:109681752-109681774 ACATTCTTCCGGATCCAGCAGGG - Intronic
978587020 4:110284256-110284278 CCATCCCTCCGAATCCGGCAGGG - Intergenic
978909027 4:114044544-114044566 CCATCCCTCCGGATCCAGCAGGG + Intergenic
979136000 4:117113853-117113875 CTATCCCTCCAGATCGGGCAGGG - Intergenic
979910837 4:126363718-126363740 CCATCCCTCCAGATCTGGCAGGG + Intergenic
980190527 4:129519371-129519393 CCATCCCTCTGGATCCCGCAGGG + Intergenic
980523658 4:133961759-133961781 CCACCCCTCCAGATACGGCAGGG + Intergenic
980625724 4:135372344-135372366 CCATCCCTCTGGTTCCAGCAGGG + Intergenic
980683945 4:136201413-136201435 CCATCCTTCCGGATCTGGCAGGG + Intergenic
980790439 4:137613314-137613336 CCATCCCTGCGGATCCTGCAGGG + Intergenic
980871964 4:138622092-138622114 CCACCCCTCCAGATCCAGCAGGG - Intergenic
981740766 4:147999480-147999502 CCATCCCTCCGGATCCGGCAGGG + Intronic
982978791 4:162104114-162104136 CCATCCCTCCGGATCCAGCAAGG + Intronic
983777803 4:171629926-171629948 CCATCCCTCTGGATCCGGCAGGG + Intergenic
984280662 4:177666598-177666620 CCACCCCTCCAGACCCAGCAGGG - Intergenic
985226364 4:187765563-187765585 CCATCCCTCCGGATCCAGCAGGG + Intergenic
986492610 5:8307802-8307824 CCACACCTCAGGATCCGGCAGGG - Intergenic
986915428 5:12613642-12613664 CCATCCCTCCTTACCCAGAAGGG - Intergenic
986918834 5:12660718-12660740 CCATCCCTCCGGATCCACCAGGG - Intergenic
987129619 5:14848566-14848588 CCACCCCTCCAGATTCGGCAGGG + Intronic
987502696 5:18733522-18733544 CCATCCCTTCGGATCCGGCAGGG - Intergenic
987508234 5:18800470-18800492 CCATCCCTCCGGATCCGGCAGGG + Intergenic
987761175 5:22164439-22164461 CCATCCCTCAGGATCCAGCAGGG - Intronic
987855132 5:23411346-23411368 CCACCCCTCCGGATCCAGCAGGG + Intergenic
987934899 5:24451245-24451267 CCACCCCTCCAGATCCGGCAGGG - Intergenic
987934910 5:24451312-24451334 CCACCCCTCCGGATCCAGCAGGG - Intergenic
988099678 5:26660306-26660328 CCACCCCTCCGGATCTGACAGGG - Intergenic
988182546 5:27816269-27816291 CCACCCCTCTGGATCCCGCAGGG - Intergenic
988881482 5:35508174-35508196 CCACCCCTCTGGATCCAGCAAGG + Intergenic
988957389 5:36332934-36332956 CCATCCTTCTGGATCCAGCAGGG - Intergenic
989717706 5:44483538-44483560 CCACCCCTCTGGATCCGGAAGGG + Intergenic
990478811 5:56187587-56187609 CTATCCCTCTGGATCCAGCAGGG + Intronic
990564444 5:57015186-57015208 CAACCCCTCCAGATCCAGCAGGG - Intergenic
990741381 5:58915966-58915988 CTATCCCTCTGGATCTGGCAGGG + Intergenic
990891816 5:60658917-60658939 CCACCCCTCCGGATCCAGCAGGG + Intronic
990892813 5:60666123-60666145 CCACCCCTCCAGATCCGGGAGGG + Intronic
990905187 5:60795661-60795683 CCAACCCTCCGGATCCGGCAGGG + Intronic
991290620 5:65030902-65030924 CCATCCGTCCAGATCCAGCAGGG + Intergenic
991895965 5:71397893-71397915 CCATCCCTCAGGATCCAGCAGGG - Intergenic
992293504 5:75304616-75304638 CCACCCCTCTGGATCTGGCAGGG + Intergenic
992761459 5:79954255-79954277 CCAGCCCTCCAGAGCCAGCCTGG + Intergenic
993054981 5:82970942-82970964 CCATCCCTCCGGATCCAGCAGGG - Intergenic
993187304 5:84636119-84636141 CCATCCCACCAGCTGCAGCAGGG - Intergenic
993225650 5:85165372-85165394 CCATCCCTCCAGATCCAGCAGGG + Intergenic
993305764 5:86272975-86272997 CCATCCCTCCGGATCTGGCACGG - Intergenic
993460750 5:88177684-88177706 CCATCCCTCCAGATCTGGCAGGG - Intergenic
993590956 5:89794677-89794699 CCATCCCTCCAGATCCAAAAGGG + Intergenic
993622817 5:90188232-90188254 CCACCCCTCTGGATCCAGCAGGG - Intergenic
993642090 5:90417641-90417663 TCCACCCTCCAGATCCAGCAGGG - Intergenic
993982345 5:94557938-94557960 CCATCCCTCTGGATCTGGCAGGG + Intronic
995125588 5:108574443-108574465 CCATCCCTCCAGATCCAGCAGGG - Intergenic
995466160 5:112451139-112451161 CCATCCCTCCAGATCTGGCAGGG + Intergenic
995717286 5:115092662-115092684 CCACCCCTCCGGATCTGGCAGGG + Intergenic
995785073 5:115819044-115819066 CCACCCCTCCAGATCCGGCAGGG - Intergenic
996128280 5:119751571-119751593 CCATCCCTCCAGATCCGGCAGGG + Intergenic
996322001 5:122229198-122229220 CTATCCCTTCAGATCCCGCAGGG - Intergenic
996939807 5:128990896-128990918 CCACCCCTCCAGATCCAGCAGGG - Intronic
998092777 5:139380814-139380836 CCATCTCTCCAGAGCCAGTATGG + Exonic
998122116 5:139587293-139587315 CCATCCCTCCGGATGGAGCAGGG - Intronic
998644322 5:144045580-144045602 CCATCCCTCCAGATCCAGCAGGG + Intergenic
998665971 5:144297981-144298003 TCATCCCTCTGGATTCGGCAGGG + Intronic
1000095460 5:157967416-157967438 CCATCCCTCCGGAACCGGCAGGG + Intergenic
1001597148 5:172905652-172905674 CCACCCCTCTGGATCCGGCAGGG - Intronic
1003661300 6:8064569-8064591 GCATCCGCCCTGATCCAGCATGG - Intronic
1004236366 6:13878502-13878524 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1004256420 6:14068854-14068876 CCATCCCTCCGGATCTGGCAGGG + Intergenic
1005297500 6:24440927-24440949 CCATCCCTCAGTATCCACGAAGG + Intronic
1005324130 6:24682630-24682652 CCATCCCTCCGGATCCAGCAGGG - Intronic
1006512156 6:34527258-34527280 CCCGCCCGCCGCATCCAGCACGG - Intronic
1007011961 6:38426569-38426591 CCATTCTTCCGGATCCGGCAGGG + Intronic
1007181161 6:39930298-39930320 CCAGCCCTCCTGAGCAAGCAGGG - Intronic
1007321941 6:41033949-41033971 CCATACCTTGGCATCCAGCAGGG + Exonic
1008582767 6:52921471-52921493 CCATACCTCTGGATCCAGCAGGG - Intergenic
1008957339 6:57230169-57230191 CCATCCCCCAGGATCCTGAATGG - Intergenic
1009519540 6:64664028-64664050 CCATCCCTCCAGATCGGGCAGGG - Intronic
1010895036 6:81351524-81351546 CCATTCTTCCGGATCTGGCAGGG + Intergenic
1011076393 6:83443926-83443948 TCACCCCTCCGGCTCCAGCAGGG + Intergenic
1011189079 6:84712021-84712043 CCACCCCTCTGGATCTGGCAGGG - Intronic
1011540383 6:88421313-88421335 CCATCCCTCTGAATCCGGCAGGG - Intergenic
1012120023 6:95354776-95354798 CCACCCCTCCGGATCCAGCAGGG + Intergenic
1012734532 6:102921656-102921678 CCATCCCTCCGGATCTGGCAGGG - Intergenic
1013021764 6:106228301-106228323 CCATCCCTCTGGATCTAGCAGGG + Intronic
1013410515 6:109879646-109879668 CCACCCCTCTGGATCTGGCAGGG + Intergenic
1013543082 6:111131184-111131206 CCACCCCTCTGGATCCGGCAGGG + Intronic
1014208920 6:118687799-118687821 CCATCCCTCCAGATCTGGCAGGG + Intronic
1014243348 6:119041704-119041726 CCACCCCTCCGGATCCGGCAGGG + Intronic
1015587364 6:134789669-134789691 CCATCCCTCCTCACCAAGCAGGG + Intergenic
1015632773 6:135247991-135248013 CCACCCCTCTGGATCCAGCAGGG + Intergenic
1016343643 6:143087521-143087543 CCATCCCTCTGGATCTGGCAAGG - Intronic
1016444918 6:144121377-144121399 CCACCCCTCCGGATCCAGCAGGG - Intergenic
1017622800 6:156316564-156316586 CCATCCATGTGGATCCAGAAAGG + Intergenic
1017868997 6:158470199-158470221 CCATCCCTCCGAATCTGGCAGGG - Intronic
1018262809 6:161987403-161987425 TCATCCCTCAGTATCCAGGAGGG + Intronic
1018760558 6:166891239-166891261 CCATCCCTCCGGATCCTGCAGGG + Intronic
1019327288 7:444718-444740 CCATCCATCCTGACCCAGGAGGG + Intergenic
1020906215 7:14067257-14067279 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1021126224 7:16853393-16853415 TCACCTCTCCAGATCCAGCAGGG + Intergenic
1021144261 7:17065947-17065969 CCACCCCTCCAGATCGGGCAGGG + Intergenic
1021885333 7:25131906-25131928 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1022090813 7:27106898-27106920 GCAGCCCTCTGGCTCCAGCATGG - Exonic
1022117661 7:27276512-27276534 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1022137789 7:27465780-27465802 ACATCCCTCCGGATTCACAAAGG - Intergenic
1022505721 7:30907794-30907816 CCATTCCTCTGGGGCCAGCAGGG - Intergenic
1022989921 7:35696686-35696708 CCATCCCTCTGGATCCAGCGAGG + Intergenic
1023438994 7:40167775-40167797 CCACCCCTCCAGATCTGGCAGGG - Intronic
1023439765 7:40173321-40173343 CCACCCCTCCGGATCTGGCAGGG - Intronic
1023733128 7:43210797-43210819 CCACCCCTCTGGATCTGGCAGGG - Intronic
1025716569 7:63962592-63962614 CCATCCCTCCAGATCCGGCAGGG - Intergenic
1026213089 7:68324156-68324178 CCATCCCTCCGGATCCAGCAGGG + Intergenic
1026346978 7:69482852-69482874 CCACCCCTCCAGATCCGGCAGGG + Intergenic
1027868356 7:83675029-83675051 CCATACCTCCGGATCCGGCAGGG - Intergenic
1028013992 7:85684152-85684174 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1028147059 7:87330027-87330049 CCACCCCTCTGGATCCAGCAGGG - Intergenic
1028587718 7:92468264-92468286 CCATCCCTCTGGATCATGCAGGG - Intergenic
1028589081 7:92477751-92477773 CCATCCCTCTGGATCCTGCAGGG - Intronic
1028926143 7:96358676-96358698 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1028993394 7:97074837-97074859 CCATCCCTCCGGATCCGACAGGG + Intergenic
1029015978 7:97315978-97316000 CCATCCCTCTGGATCTGGCAGGG + Intergenic
1029607043 7:101605519-101605541 CCAGGCCTCCGGGGCCAGCAGGG + Intergenic
1030208389 7:106972732-106972754 TCACCCCTCCGGATCCGGCCAGG - Intergenic
1030336815 7:108337451-108337473 CCATCCCTCTGGATCTGGCAGGG + Intronic
1030431262 7:109452224-109452246 CCACCCCTCCGAATCCCGCAGGG + Intergenic
1030661156 7:112221080-112221102 CCACCCTTCCAGATCCAGCAGGG + Intronic
1030843972 7:114386114-114386136 CCATCCCTCTGGATCCGGCAGGG - Intronic
1031250868 7:119378909-119378931 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1031299582 7:120047511-120047533 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1031472006 7:122177236-122177258 CCACCCCTCCGGATCCATCAGGG + Intergenic
1031742818 7:125455898-125455920 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1032425783 7:131821157-131821179 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1032653851 7:133906731-133906753 CCATCCCTCCAGATCCGGCAGGG + Intronic
1032726301 7:134592677-134592699 CCACCTCTCTGGGTCCAGCAGGG + Intergenic
1034248775 7:149671742-149671764 CCACCCCTCTGGATCTGGCAGGG + Intergenic
1034249503 7:149676862-149676884 CCACCCTTCTGGATCCAGCAGGG + Intergenic
1034338398 7:150337796-150337818 CCATCCCTCCACATGCTGCAAGG + Exonic
1034650836 7:152688820-152688842 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1034965003 7:155385365-155385387 CCATCCCTCCGGATCCAGCAGGG - Intronic
1037379951 8:18274615-18274637 CCACCCCTCAGGATCCAGCAGGG - Intergenic
1037570611 8:20154881-20154903 CCACCCCTCCAGATCTGGCAGGG + Intronic
1037648683 8:20817019-20817041 CCATCCCTCCGGATCCGTCAGGG - Intergenic
1038742243 8:30225901-30225923 CCATCCCTCTGGATCCGGCAGGG - Intergenic
1039566344 8:38554759-38554781 CCATCCCCCAGGCTCCAACATGG - Intergenic
1040768446 8:50944260-50944282 CCACCCCTCCGGATCCAGCAGGG - Intergenic
1041664086 8:60425331-60425353 CCACCCCTCGGGATCCGGCAGGG - Intergenic
1041741907 8:61165197-61165219 CCATTCTTCCGGATCCAGCAGGG - Intronic
1042055662 8:64763122-64763144 CCACCCCTCCGGATCCAGCAGGG + Intronic
1043087302 8:75850091-75850113 CCATCACTCTGGCTCCAGCAGGG - Intergenic
1044988284 8:97774156-97774178 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1045657597 8:104403161-104403183 CCATCTCTCCAGATCTGGCAGGG + Intronic
1045664329 8:104468973-104468995 CCACCCCTCTGAATCCAGCAGGG + Intergenic
1045788631 8:105955513-105955535 CTATCCCTCCAGATCTGGCAGGG - Intergenic
1045863507 8:106839349-106839371 CCACCCCTCAGGATCCGGCAGGG - Intergenic
1047276659 8:123410808-123410830 CTATCCCTCCAGATCCGGCAGGG + Intronic
1047599738 8:126413925-126413947 CCACCCCTCCAGATCCGGTAGGG - Intergenic
1047618320 8:126581368-126581390 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1047766120 8:127991524-127991546 CCAGCCCTCCAGGTGCAGCAGGG - Intergenic
1048100250 8:131343185-131343207 CCACCCTTCTGGATCCGGCAGGG - Intergenic
1048374993 8:133815482-133815504 CCATCCCTCAGTATCCATCAAGG + Intergenic
1048631499 8:136247692-136247714 CCACCCCTCTGGATCTGGCACGG + Intergenic
1049329548 8:142042962-142042984 CCCTCTCCCCGGGTCCAGCAGGG - Intergenic
1049366135 8:142237750-142237772 CCCTCCCTCCGCATCCACCCGGG - Intronic
1049604615 8:143523531-143523553 CCATCCCTCAGGCACCAGCTTGG + Intronic
1050116051 9:2264560-2264582 CCACCCCTCCGGATCCGGCAGGG - Intergenic
1050122115 9:2318006-2318028 CCATCCCTCCCTCTGCAGCATGG - Intergenic
1050593508 9:7183588-7183610 CCATCCCTCTGGATCAGGCAGGG + Intergenic
1051699186 9:19801375-19801397 CCATCCCTCGGCATCCAGCAGGG - Intergenic
1051870083 9:21727308-21727330 CCATCCCTTCAGATCCGGCAGGG + Intergenic
1051970169 9:22878030-22878052 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1053134326 9:35640620-35640642 CCATCCCTCCAGATCCGGCAGGG - Intronic
1053215200 9:36265056-36265078 CCACCCCTCCGGATCTGGCAGGG + Intronic
1055049588 9:71964991-71965013 CCATCCCTCTGGATCCGGTAGGG - Intronic
1055431335 9:76247177-76247199 CCATCCCTCCAGATCAGGCAGGG - Intronic
1055455704 9:76469652-76469674 CCATCCCTCTGGATCAGGCAGGG + Intronic
1056705005 9:88944236-88944258 CCATCCCTCTGGATCTGGCAGGG - Intergenic
1059636826 9:116179576-116179598 TCATCCCTCCGGGTCCACCCCGG - Intronic
1060739620 9:126089808-126089830 CCCTCCCTCCATCTCCAGCAGGG - Intergenic
1061037567 9:128122110-128122132 CCGGGCCTCTGGATCCAGCAGGG + Intronic
1185560920 X:1060119-1060141 CCACCCCTCCGGATCAGGCAGGG + Intergenic
1186254528 X:7703880-7703902 CCATCCCTCTGGATCCGGCAGGG - Intergenic
1186826275 X:13343208-13343230 CTCTCCCTCTGGATCCAGGAAGG - Intergenic
1187613825 X:20971901-20971923 CCATCCCTCAGGATCTGCCAGGG + Intergenic
1189152090 X:38719466-38719488 CCAACCCTCCAGATCCAGCAGGG - Intergenic
1189954268 X:46261956-46261978 CCATCCCTCCGGATCTGGCAGGG - Intergenic
1190240568 X:48654947-48654969 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1190368111 X:49716717-49716739 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1192254883 X:69448024-69448046 CCACCCCTCCAGATCTGGCAGGG + Intergenic
1192803101 X:74485839-74485861 CCACCCCTCCGGATCCGGCAGGG - Intronic
1192961005 X:76130784-76130806 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1193172379 X:78350328-78350350 CCTCCCCTCTGGATCCAGCAGGG - Intergenic
1193295486 X:79827523-79827545 CCATCCCTCCGGATATGGCAGGG - Intergenic
1193306259 X:79956083-79956105 CCATGCCTCCAGATCCAGCAGGG + Intergenic
1194103273 X:89734542-89734564 CCATCCCTCCGGATCCCGCAGGG - Intergenic
1194154497 X:90370255-90370277 CCATCTCTCTGGATCCGGCAGGG - Intergenic
1194445392 X:93981447-93981469 CCATCACTCCGGATCCGGTAGGG - Intergenic
1195243675 X:102977856-102977878 TCACCCCTCCGGATCCAGCAGGG + Intergenic
1195256579 X:103096819-103096841 CCACCCCTCCGGATCCAGCAGGG + Intergenic
1195259083 X:103115357-103115379 CTACCCCTCCAGATCCAGCAGGG - Intergenic
1195287145 X:103396409-103396431 CCATTCCCCCGGCCCCAGCAGGG - Intergenic
1195505074 X:105647190-105647212 CCACCCCTCCGGATCTGGCAGGG - Intronic
1195584612 X:106551436-106551458 CCATCCCTCTGGATCTGGCAGGG + Intergenic
1196258162 X:113547158-113547180 CCATCGCTCCGGATCCGGCAGGG - Intergenic
1196287271 X:113897426-113897448 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1196772518 X:119309111-119309133 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1196993639 X:121356667-121356689 TCACCCCTCCAGATCCCGCAGGG + Intergenic
1197545319 X:127816559-127816581 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1197999709 X:132420302-132420324 CCACCCCTCCAGATCCGGCAGGG - Intronic
1198566832 X:137913866-137913888 CCATCCCTCCAGATCCGGCAGGG - Intergenic
1198862338 X:141084392-141084414 CCACTCCTCCAGATCCAGCAGGG + Intergenic
1198900356 X:141502994-141503016 CCACTCCTCCAGATCCAGCAGGG - Intergenic
1199268778 X:145858460-145858482 CCATCCCTCCAGATACGGCAGGG - Intergenic
1199368816 X:147020948-147020970 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1199432084 X:147773212-147773234 CCATTCTTCAGGATCCGGCAGGG + Intergenic
1200415974 Y:2910309-2910331 CCACCCCTCCAGATCCAGCAGGG - Intronic
1200500850 Y:3947148-3947170 CCATCTCTCTGGATCCGGCAGGG - Intergenic
1200762690 Y:7054629-7054651 CCATCCCTCCAGATCTGGCAGGG + Intronic
1200851257 Y:7886363-7886385 CCACCCCTCTGGATCCAGCAGGG - Intergenic
1201329238 Y:12800048-12800070 CCACCCCTCCAGATCTGGCAGGG + Intronic
1201421481 Y:13804589-13804611 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1201642238 Y:16192156-16192178 CCACCCCTCCAGATCTGGCAGGG - Intergenic
1201660577 Y:16393165-16393187 CCACCCCTCCAGATCTGGCAGGG + Intergenic
1201905236 Y:19080361-19080383 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1201906118 Y:19087157-19087179 ACACCCCTCCAGATCCAGCAGGG + Intergenic
1201962275 Y:19694668-19694690 CCACCCCTCCAGATCCAGCAGGG - Intergenic