ID: 1196772522

View in Genome Browser
Species Human (GRCh38)
Location X:119309122-119309144
Sequence GCCACTGACTTCCATCCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196772522_1196772529 13 Left 1196772522 X:119309122-119309144 CCGGAGGGATGGAAGTCAGTGGC No data
Right 1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG No data
1196772522_1196772527 6 Left 1196772522 X:119309122-119309144 CCGGAGGGATGGAAGTCAGTGGC No data
Right 1196772527 X:119309151-119309173 GCAACGGCGGCAAACACCAGTGG No data
1196772522_1196772525 -10 Left 1196772522 X:119309122-119309144 CCGGAGGGATGGAAGTCAGTGGC No data
Right 1196772525 X:119309135-119309157 AGTCAGTGGCGGGTCTGCAACGG No data
1196772522_1196772528 9 Left 1196772522 X:119309122-119309144 CCGGAGGGATGGAAGTCAGTGGC No data
Right 1196772528 X:119309154-119309176 ACGGCGGCAAACACCAGTGGTGG No data
1196772522_1196772526 -7 Left 1196772522 X:119309122-119309144 CCGGAGGGATGGAAGTCAGTGGC No data
Right 1196772526 X:119309138-119309160 CAGTGGCGGGTCTGCAACGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196772522 Original CRISPR GCCACTGACTTCCATCCCTC CGG (reversed) Intergenic
No off target data available for this crispr