ID: 1196772529

View in Genome Browser
Species Human (GRCh38)
Location X:119309158-119309180
Sequence CGGCAAACACCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196772520_1196772529 23 Left 1196772520 X:119309112-119309134 CCTGCTGGATCCGGAGGGATGGA 0: 12
1: 72
2: 118
3: 157
4: 197
Right 1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG No data
1196772522_1196772529 13 Left 1196772522 X:119309122-119309144 CCGGAGGGATGGAAGTCAGTGGC No data
Right 1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG No data
1196772518_1196772529 24 Left 1196772518 X:119309111-119309133 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196772529 Original CRISPR CGGCAAACACCAGTGGTGGA TGG Intergenic
No off target data available for this crispr