ID: 1196775560

View in Genome Browser
Species Human (GRCh38)
Location X:119333929-119333951
Sequence GGGACTGGCCGCAGTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1324
Summary {0: 1, 1: 0, 2: 32, 3: 489, 4: 802}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196775560_1196775573 20 Left 1196775560 X:119333929-119333951 CCTGCTCTACTGCGGCCAGTCCC 0: 1
1: 0
2: 32
3: 489
4: 802
Right 1196775573 X:119333972-119333994 GGAGTGCGGGCGCATGGCGCAGG 0: 17
1: 130
2: 373
3: 480
4: 612
1196775560_1196775562 -8 Left 1196775560 X:119333929-119333951 CCTGCTCTACTGCGGCCAGTCCC 0: 1
1: 0
2: 32
3: 489
4: 802
Right 1196775562 X:119333944-119333966 CCAGTCCCATTGACCACCCAAGG 0: 77
1: 712
2: 533
3: 330
4: 347
1196775560_1196775568 6 Left 1196775560 X:119333929-119333951 CCTGCTCTACTGCGGCCAGTCCC 0: 1
1: 0
2: 32
3: 489
4: 802
Right 1196775568 X:119333958-119333980 CACCCAAGGGCTGAGGAGTGCGG 0: 455
1: 339
2: 243
3: 121
4: 334
1196775560_1196775574 25 Left 1196775560 X:119333929-119333951 CCTGCTCTACTGCGGCCAGTCCC 0: 1
1: 0
2: 32
3: 489
4: 802
Right 1196775574 X:119333977-119333999 GCGGGCGCATGGCGCAGGACTGG No data
1196775560_1196775572 14 Left 1196775560 X:119333929-119333951 CCTGCTCTACTGCGGCCAGTCCC 0: 1
1: 0
2: 32
3: 489
4: 802
Right 1196775572 X:119333966-119333988 GGCTGAGGAGTGCGGGCGCATGG 0: 188
1: 447
2: 511
3: 294
4: 391
1196775560_1196775566 -1 Left 1196775560 X:119333929-119333951 CCTGCTCTACTGCGGCCAGTCCC 0: 1
1: 0
2: 32
3: 489
4: 802
Right 1196775566 X:119333951-119333973 CATTGACCACCCAAGGGCTGAGG 0: 88
1: 767
2: 609
3: 413
4: 329
1196775560_1196775569 7 Left 1196775560 X:119333929-119333951 CCTGCTCTACTGCGGCCAGTCCC 0: 1
1: 0
2: 32
3: 489
4: 802
Right 1196775569 X:119333959-119333981 ACCCAAGGGCTGAGGAGTGCGGG 0: 497
1: 663
2: 372
3: 172
4: 320
1196775560_1196775563 -7 Left 1196775560 X:119333929-119333951 CCTGCTCTACTGCGGCCAGTCCC 0: 1
1: 0
2: 32
3: 489
4: 802
Right 1196775563 X:119333945-119333967 CAGTCCCATTGACCACCCAAGGG 0: 80
1: 738
2: 530
3: 338
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196775560 Original CRISPR GGGACTGGCCGCAGTAGAGC AGG (reversed) Intergenic
900410166 1:2509026-2509048 GGGGCTGGCCGCACTGGTGCGGG - Exonic
900661243 1:3785101-3785123 GGGGCCGGGCGCAGTACAGCAGG + Exonic
901322625 1:8348952-8348974 TGGACAGGCCTCAGCAGAGCGGG - Intergenic
901601419 1:10426386-10426408 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
901783396 1:11609049-11609071 GGGACTGGGCGCCATGGAGCAGG - Intergenic
901836131 1:11925484-11925506 GGGACCGGCCTGAGTAGAGGAGG + Exonic
902032567 1:13433874-13433896 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
902033495 1:13439580-13439602 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
902963912 1:19984518-19984540 GGGACTGGGCGCCATGGAGCAGG + Intergenic
903212381 1:21825579-21825601 GGCACTGGCCACAGTAGCTCTGG + Intronic
903624653 1:24721815-24721837 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
904238841 1:29131171-29131193 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
905038186 1:34930400-34930422 GGGACTGTCCGAAGCACAGCTGG + Intergenic
905675195 1:39819715-39819737 GGGACTGGCAGCGGAAGCGCGGG - Intergenic
905869070 1:41392619-41392641 GAGACAGGCAGCAGCAGAGCAGG - Intergenic
906563460 1:46778545-46778567 AGGACTGGGCGCCGTGGAGCAGG + Intronic
907102184 1:51847405-51847427 GGGACTGGGCGCCGTGGAGCAGG + Intronic
907371103 1:54004250-54004272 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
907889549 1:58623764-58623786 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
908027698 1:59969692-59969714 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
908291396 1:62670223-62670245 GGGACTGGGCGCTGTGGAGCAGG - Intronic
908888645 1:68818045-68818067 GGGACTGAGCGCCGTGGAGCAGG - Intergenic
909317975 1:74247927-74247949 GGGACTGGGCACCGTGGAGCAGG + Intronic
909608682 1:77531781-77531803 GGGACTGGGCGCCGTGGAGCAGG + Intronic
909904510 1:81178634-81178656 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
910034714 1:82776809-82776831 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
910550350 1:88467404-88467426 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
910609701 1:89128068-89128090 GGGACTGGGCGCCATGGAGCAGG + Intronic
910693093 1:89984689-89984711 GGGACTGGGTGCCATAGAGCAGG + Intergenic
911001497 1:93170562-93170584 GGGACTGGGTGCCGTGGAGCAGG - Intronic
911259543 1:95669655-95669677 GGGACTGGCTGCCGTGGAGCAGG + Intergenic
911305180 1:96224365-96224387 GGGACTGGGCGCCGGGGAGCAGG + Intergenic
911597540 1:99814100-99814122 GGGAGTGACATCAGTAGAGCGGG - Intergenic
911839192 1:102660039-102660061 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
912058068 1:105631262-105631284 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
912309353 1:108604199-108604221 GGGATTGGACGCAGTAGATCAGG + Intronic
912538700 1:110396356-110396378 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
913227064 1:116709712-116709734 GGTGCTGGCAGCAGCAGAGCTGG - Intergenic
913274192 1:117121771-117121793 TGGACTCGCCGGAGTAGACCGGG - Intronic
913469050 1:119171838-119171860 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
913486156 1:119334039-119334061 GGGACTGGGAGCGGTGGAGCAGG - Intergenic
913692059 1:121289131-121289153 GGGACTGGGCGCCATGGAGCAGG + Intronic
914145499 1:144990983-144991005 GGGACTGGGCGCCATGGAGCAGG - Intronic
914438384 1:147680793-147680815 GGGACTGGGCGCCATGGAGCAGG + Intergenic
914689810 1:150015762-150015784 GAGATTGGCCTCAGTAGAGGGGG + Intergenic
914928114 1:151906470-151906492 GGGACTGGGCGCCGTGGAGCAGG - Intronic
915104177 1:153522110-153522132 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
915666053 1:157446310-157446332 GGGACTGGGCGCCATGGAGCAGG + Intergenic
915764436 1:158349016-158349038 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
915767110 1:158374182-158374204 GGGACTGTGCGCAGTGGAGCAGG + Intergenic
915931384 1:160062624-160062646 GGGACTGGTAGGAGTGGAGCGGG + Intronic
916040089 1:160954308-160954330 GGGCCTGGAGGGAGTAGAGCTGG - Intronic
916219922 1:162433485-162433507 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
916910059 1:169337102-169337124 GGGACTGGGCGCCATGGAGCAGG + Intronic
916939079 1:169661506-169661528 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
916960337 1:169882443-169882465 GGGACTGGGCTCCGTGGAGCAGG - Intronic
917348815 1:174056436-174056458 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
917446312 1:175108484-175108506 GGGACTGGGCGCCGTGGAGCAGG + Intronic
917578496 1:176349294-176349316 GGGACTGGGCGCCATGGAGCAGG + Intergenic
918511965 1:185321742-185321764 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
918659709 1:187073843-187073865 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
918708995 1:187703953-187703975 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
918720887 1:187850535-187850557 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
918732252 1:188013348-188013370 GGGACTCGGCGCCGTGGAGCAGG + Intergenic
918791985 1:188841202-188841224 GGGACTGGGCGCTTTGGAGCAGG + Intergenic
918853157 1:189718326-189718348 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
918952047 1:191151715-191151737 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
918993939 1:191732104-191732126 GGGACTGCGCGCCGTTGAGCAGG - Intergenic
919091959 1:192987242-192987264 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
919174522 1:194002174-194002196 GGGACTGGGCGCCATGGAGCAGG - Intergenic
919201299 1:194358297-194358319 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
919237071 1:194859333-194859355 GGGACTGGGCGCTGTGGAGCTGG - Intergenic
919250884 1:195054611-195054633 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
919297721 1:195722941-195722963 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
919630998 1:199959953-199959975 GGGACTGGGCGCCGTGAAGCAGG - Intergenic
919765786 1:201126708-201126730 GGGCCTGGCCACAGGAGAGATGG - Intronic
920098915 1:203504635-203504657 GGCCCTGGCCTCAGAAGAGCAGG - Intronic
920385585 1:205568740-205568762 GGGACTGGTCGAGGGAGAGCGGG + Intergenic
920479380 1:206307479-206307501 GGGACTGGGCGCCATGGAGCAGG + Intronic
920731316 1:208488465-208488487 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
920883097 1:209898827-209898849 GGGACTGGGCACCGTGGAGCAGG + Intergenic
921096311 1:211889744-211889766 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
921396326 1:214673174-214673196 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
921801864 1:219410985-219411007 GGGACTGGGCGCCATGGAGCAGG - Intergenic
921897148 1:220412765-220412787 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
921903778 1:220475696-220475718 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
921983617 1:221285685-221285707 GGGACTAGGCGCTGTGGAGCAGG + Intergenic
922056881 1:222050079-222050101 GGGACTGGGCTCCGTGGAGCAGG - Intergenic
922166083 1:223116989-223117011 GGGACCGGGCGCCGTGGAGCAGG + Intronic
922306926 1:224352546-224352568 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
922423266 1:225473040-225473062 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
922485482 1:225970098-225970120 GGGACTGGGCGCCATGGAGCAGG - Intergenic
922846471 1:228688950-228688972 GAGACTGGCAGCAGTAAAGGTGG + Intergenic
922855848 1:228774037-228774059 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
923193405 1:231641976-231641998 GGGACTGGGCGCTGTGGAGCAGG + Intronic
923324758 1:232871471-232871493 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
923573872 1:235140627-235140649 GGGACTGGGCGTCGTGGAGCAGG - Intronic
924117577 1:240762822-240762844 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
924219181 1:241855607-241855629 GAGACTGGGCGCCGTGGAGCAGG + Intronic
1063318671 10:5032546-5032568 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1063321007 10:5053172-5053194 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1063322142 10:5060714-5060736 GGGACTTGGCGCTGTGGAGCAGG + Intronic
1063769753 10:9183682-9183704 GGGATTGGGCGCCGTGGAGCAGG - Intergenic
1064197845 10:13259939-13259961 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1065441391 10:25756331-25756353 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1065743223 10:28815701-28815723 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1065752126 10:28896847-28896869 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1065802660 10:29366512-29366534 GGGACTGGGCGCTGTGGAGTAGG - Intergenic
1065995560 10:31056155-31056177 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1066186359 10:33013625-33013647 GGGACTGGGCGCCGTGGAGTAGG - Intergenic
1066190322 10:33049559-33049581 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1066234101 10:33468366-33468388 GGGACTGGGCTCCGTGGAGCAGG - Intergenic
1066235405 10:33480495-33480517 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1066293673 10:34035720-34035742 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1066544191 10:36482025-36482047 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1066567344 10:36734646-36734668 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1066615011 10:37285195-37285217 GGGACTGGCCGCCGTGGAGCAGG + Intronic
1067068610 10:43117210-43117232 GGGCCTGGCCACAGAAGAGGGGG - Intronic
1068374080 10:56155456-56155478 GGGACTGAGCGCCGTGGAGCAGG - Intergenic
1068455585 10:57250173-57250195 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
1068820911 10:61376903-61376925 GGGACTGGGCGTTGCAGAGCAGG + Intergenic
1068863225 10:61867977-61867999 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1068902168 10:62280711-62280733 GGGACTGGGTGCGGTGGAGCAGG - Intergenic
1068978196 10:63033922-63033944 GGGACTAGGCGCCGTGGAGCAGG - Intergenic
1069186469 10:65429435-65429457 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1069280781 10:66651489-66651511 GGGACTGGGCGCCGCAGAGAAGG + Intronic
1069766198 10:70861976-70861998 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1069943760 10:71972503-71972525 GGGAGTGGCATCAGCAGAGCGGG - Intronic
1069988735 10:72300936-72300958 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1069993029 10:72326287-72326309 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1070564041 10:77590308-77590330 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1070968363 10:80543547-80543569 GAGACTGGGCGCCGTGGAGCAGG - Intronic
1071003814 10:80859587-80859609 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1071037424 10:81264941-81264963 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1071041037 10:81309102-81309124 GGGACGGGGCGCGGTGGAGCAGG + Intergenic
1071388060 10:85141733-85141755 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1071900954 10:90119856-90119878 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1072217704 10:93301927-93301949 GGGCCTGGACCCAGAAGAGCTGG + Intergenic
1072278538 10:93845486-93845508 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
1073249703 10:102114264-102114286 GGGACTGGCCACAGGTCAGCAGG + Intronic
1073789719 10:106928132-106928154 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1074098190 10:110331799-110331821 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1074317212 10:112370658-112370680 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
1074473692 10:113750390-113750412 GGGAGTGGGAGCAGTAGAGTTGG + Intergenic
1074497895 10:113996078-113996100 GGGAAGGGCCGCAGGAGAGGAGG - Intergenic
1075255678 10:120924158-120924180 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
1075307672 10:121382452-121382474 GGGACTGGGCACGGTGGAGCAGG - Intergenic
1075504949 10:123013529-123013551 GGGACTGGGTGCAGTGGAGCAGG + Intronic
1075537467 10:123283380-123283402 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1076261602 10:129071379-129071401 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1076417352 10:130301115-130301137 GGGCCTGCACGCAGGAGAGCGGG - Intergenic
1076417477 10:130301582-130301604 GGGCCTGCCAGCAGGAGAGCGGG - Intergenic
1076773668 10:132680986-132681008 GGGACTGGGCGCCCTGGAGCAGG - Intronic
1076796480 10:132800972-132800994 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1077583748 11:3435012-3435034 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1077603282 11:3589013-3589035 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1077764646 11:5144729-5144751 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1077805820 11:5590212-5590234 GGGACTGGGCGCCCTGGAGCAGG - Intronic
1077815654 11:5683237-5683259 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1078301143 11:10133331-10133353 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1078743638 11:14091354-14091376 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1078795876 11:14591397-14591419 GGGACTGGGCGCCCTGGAGCAGG - Intronic
1079190934 11:18276163-18276185 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1079414035 11:20216214-20216236 GGGAGTGGAGGCAGCAGAGCAGG - Intergenic
1079555373 11:21753169-21753191 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1079731702 11:23942305-23942327 GGGACTGGGCACTGTGGAGCAGG + Intergenic
1079767721 11:24416027-24416049 GGGTCTGGGCGCCGTGGAGCAGG + Intergenic
1080105974 11:28512360-28512382 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1080107449 11:28525824-28525846 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1080195144 11:29600175-29600197 GGGACTGGGAGCCGTGGAGCAGG + Intergenic
1080557638 11:33431771-33431793 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1081115297 11:39192659-39192681 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1081126883 11:39333096-39333118 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1081329654 11:41788252-41788274 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1081422123 11:42881716-42881738 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1081428440 11:42950219-42950241 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
1082698705 11:56401947-56401969 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1083007938 11:59366395-59366417 GGGACTGGCTGATGTAGAGTAGG - Intergenic
1083541789 11:63516369-63516391 AGGAGTGGACACAGTAGAGCTGG - Exonic
1083546165 11:63550538-63550560 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
1084024697 11:66440805-66440827 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1084107466 11:66989126-66989148 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
1084186696 11:67476386-67476408 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1084210519 11:67619370-67619392 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1084240649 11:67817684-67817706 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1084259181 11:67963556-67963578 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1084831778 11:71775028-71775050 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
1084981559 11:72831652-72831674 GGGAATGGCCTCAGTAGACTAGG - Intronic
1085447196 11:76609056-76609078 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1085671040 11:78464997-78465019 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1085863191 11:80257894-80257916 GGGACTGGGCGCCCTTGAGCAGG - Intergenic
1085953987 11:81368418-81368440 GGGACTGGGCACAGCAGAACAGG + Intergenic
1086034960 11:82404224-82404246 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1086043087 11:82501491-82501513 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1086210069 11:84308577-84308599 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1086244829 11:84740166-84740188 GGAAATGGCTGCAGTACAGCAGG + Intronic
1086724684 11:90167475-90167497 GGGACTGGTCGCCGTGGAGCAGG - Intronic
1086808071 11:91269089-91269111 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1087407262 11:97745642-97745664 GGGACTAGGCGCAGCGGAGCAGG + Intergenic
1087486335 11:98763436-98763458 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1087977208 11:104564979-104565001 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1088570932 11:111222310-111222332 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1088843913 11:113649376-113649398 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
1088853049 11:113721255-113721277 GAGACTGGAAGCAGCAGAGCAGG + Intergenic
1089373514 11:117978514-117978536 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1089466350 11:118689003-118689025 GGGACTGGGCACCGTGGAGCGGG + Intergenic
1089666918 11:120026233-120026255 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
1089800298 11:121021993-121022015 GTGACTGGGCGCCGTGGAGCAGG - Intergenic
1090133508 11:124170748-124170770 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1090162497 11:124510337-124510359 GGCACTGGCGGGAATAGAGCTGG + Intergenic
1090229282 11:125089830-125089852 GGGACTGGGCGCCCTGGAGCAGG - Intronic
1090243734 11:125201451-125201473 AGGAATGGCCACAGAAGAGCAGG + Intronic
1090307627 11:125704729-125704751 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1090776668 11:129971859-129971881 GGGACTGGGTGCCGTAGAGCAGG + Intronic
1091104996 11:132910228-132910250 GGGACTGGCAGTGGTACAGCAGG + Intronic
1091201257 11:133782632-133782654 GGGACTGGGCACAGTAGAGCAGG - Intergenic
1091233400 11:134002916-134002938 GGGACTGGGCGCCGTGGAGCGGG + Intergenic
1091351563 11:134901662-134901684 GGGACAGCCCACAGTAGAGGTGG - Intergenic
1092135258 12:6142530-6142552 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1092220341 12:6708616-6708638 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1092272979 12:7037754-7037776 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1092336735 12:7640172-7640194 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1092350462 12:7752096-7752118 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1092364110 12:7862519-7862541 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1092471824 12:8787600-8787622 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1092473019 12:8795059-8795081 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1092572363 12:9739603-9739625 GGGACTGGGCGCCGTGAAGCAGG + Intergenic
1092583783 12:9876198-9876220 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1092617096 12:10225655-10225677 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1092834170 12:12472461-12472483 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1093034555 12:14320427-14320449 GGGACTGGGCGCCCTGGAGCGGG - Intergenic
1093189457 12:16057708-16057730 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1093266329 12:17007957-17007979 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1093381619 12:18500478-18500500 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1093652605 12:21661861-21661883 GGGACTGGGCGCAGTGGAGCAGG - Intronic
1093653856 12:21674034-21674056 GGGACTGGGCGCAGTGGAGCAGG + Intronic
1093793774 12:23286261-23286283 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1093970265 12:25369699-25369721 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1093973013 12:25391762-25391784 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1094338548 12:29386268-29386290 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1094409893 12:30157193-30157215 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1094589245 12:31805816-31805838 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1094661339 12:32472625-32472647 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1094666540 12:32526005-32526027 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1094718142 12:33033958-33033980 GGGACTGGGCGCCGTGGGGCAGG + Intergenic
1095478595 12:42610974-42610996 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1095534016 12:43224613-43224635 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
1097017866 12:56000173-56000195 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1097128882 12:56795866-56795888 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1097212984 12:57386602-57386624 GGGACTGGGCGCGGTGGAGCAGG - Intronic
1097664145 12:62461301-62461323 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1097982056 12:65744648-65744670 GGGACTGGGCGCCGTAGGGCTGG - Intergenic
1098168162 12:67719259-67719281 GGTACTGGGCGCCGTGGAGCAGG + Intergenic
1098588732 12:72185379-72185401 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1098759293 12:74403280-74403302 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1099190161 12:79554056-79554078 GGGACGGGGCGCTGTGGAGCAGG + Intergenic
1099192482 12:79574205-79574227 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1099204412 12:79711272-79711294 GGGACAGGGCGCTGTGGAGCAGG - Intergenic
1099523887 12:83696322-83696344 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1099559569 12:84155150-84155172 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1099716178 12:86296429-86296451 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1100166567 12:91923935-91923957 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1100211829 12:92406545-92406567 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1100521510 12:95379918-95379940 GGGACTGGGCACCGTGGAGCAGG - Intronic
1100584747 12:95969467-95969489 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1100734581 12:97512812-97512834 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1101009046 12:100430635-100430657 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1101021680 12:100559715-100559737 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1101461909 12:104905539-104905561 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1102309815 12:111835986-111836008 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1102904066 12:116661015-116661037 GGGACTGGGCCCCGTGGAGCAGG - Intergenic
1103146091 12:118597203-118597225 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1103439169 12:120950353-120950375 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1103459614 12:121093562-121093584 GGGACTGGGCGCCGTGGGGCAGG + Intergenic
1103678663 12:122676663-122676685 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1104344548 12:127983718-127983740 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1104582691 12:130022388-130022410 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1104614461 12:130256681-130256703 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1104749297 12:131228145-131228167 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1104825841 12:131709128-131709150 GGGACTGGCTGAAGTAGCCCAGG - Intergenic
1105037808 12:132939087-132939109 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1105722225 13:23127904-23127926 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1105777587 13:23677856-23677878 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1105805854 13:23951247-23951269 GGGAGGGGCAGCAGTAGAGATGG - Intergenic
1105876632 13:24560733-24560755 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1106221272 13:27748341-27748363 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1106408730 13:29496454-29496476 GGCACTGCCAGCAGGAGAGCTGG + Intronic
1106440557 13:29763339-29763361 GGGACAAGCCGCAGCAGAGTGGG - Intergenic
1106600507 13:31183079-31183101 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1106617010 13:31339693-31339715 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1106643380 13:31608856-31608878 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1106811003 13:33358314-33358336 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1107259328 13:38472457-38472479 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1107590409 13:41898606-41898628 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1107836169 13:44413908-44413930 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1108435400 13:50396922-50396944 GGGACTGGGCGCCCTGGAGCAGG - Intronic
1108469403 13:50753334-50753356 GGGACTGGGCGCCCTGGAGCAGG + Intronic
1108643924 13:52408102-52408124 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1108685412 13:52815284-52815306 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1108750171 13:53439981-53440003 GGGACTGGTCGCAGCGGAGCAGG - Intergenic
1108751483 13:53452421-53452443 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1108996054 13:56735896-56735918 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1109124667 13:58504298-58504320 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1109141102 13:58714416-58714438 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1109145446 13:58773605-58773627 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1109159823 13:58958209-58958231 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1109364690 13:61339502-61339524 GGGACCCGGCGCAGTGGAGCAGG - Intergenic
1109446556 13:62447926-62447948 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1109506198 13:63306065-63306087 GGGACCGGGCGCGGTGGAGCAGG - Intergenic
1109563113 13:64077562-64077584 GGGACTGGGCGCCGTGGATCAGG + Intergenic
1109745869 13:66622282-66622304 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1110417532 13:75268782-75268804 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1110609774 13:77475523-77475545 GGGACTGGGCGCTGTGGAACAGG + Intergenic
1110751347 13:79119664-79119686 GGGACTGGGAGCGGTGGAGCAGG + Intergenic
1110792348 13:79600185-79600207 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1110862190 13:80355870-80355892 GGGACTGGGCGCCTCAGAGCAGG - Intergenic
1110940241 13:81340798-81340820 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1110999787 13:82164974-82164996 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1111138741 13:84086441-84086463 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1111441958 13:88292153-88292175 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1111556123 13:89883893-89883915 GGGACTGGCCGCCGTGGAGCAGG + Intergenic
1111591084 13:90348932-90348954 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1111602777 13:90495113-90495135 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1111747726 13:92291179-92291201 GGGACTGGGCACAGTGGAGCAGG - Intronic
1111919561 13:94396129-94396151 GGGGCTGGCCACAGGAGAGGGGG - Intronic
1112077696 13:95931464-95931486 GGGACTGGGCGCCGCGGAGCAGG + Intronic
1112226559 13:97545618-97545640 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
1112282647 13:98076362-98076384 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
1112518699 13:100077849-100077871 GGGACTGGGCGCCGTAGAGCAGG - Intergenic
1112533116 13:100224076-100224098 GGGACTGGGCACCGTGGAGCAGG + Intronic
1112613153 13:100976029-100976051 GGGACTGGGCTCCGTGGAGCAGG - Intergenic
1113371899 13:109732696-109732718 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1113482630 13:110633056-110633078 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1113506688 13:110821493-110821515 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1113538076 13:111083899-111083921 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1113678107 13:112222050-112222072 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1114560256 14:23584908-23584930 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1114593591 14:23892091-23892113 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1115118345 14:29909345-29909367 GGGACTGGGCGCCATGGAGCGGG - Intronic
1116114448 14:40629668-40629690 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1116250983 14:42482420-42482442 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1116311062 14:43326936-43326958 GGGACAGGGCGCCGTGGAGCAGG - Intergenic
1116325865 14:43533367-43533389 GGGACTGGACGCAATGTAGCAGG - Intergenic
1116390578 14:44385076-44385098 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1116426642 14:44799021-44799043 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1116452414 14:45080769-45080791 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1117077919 14:52122577-52122599 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1117297616 14:54393773-54393795 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1117302568 14:54443385-54443407 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1117449863 14:55839800-55839822 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1117565684 14:56991350-56991372 AGGACTGGGCGCCGTGGAGCAGG - Intergenic
1117571872 14:57056643-57056665 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1118215317 14:63803291-63803313 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1118306365 14:64658463-64658485 GGGACTGGGCGTGGTGGAGCAGG - Intergenic
1118558862 14:67056751-67056773 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1118932474 14:70255176-70255198 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1119027824 14:71167826-71167848 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1119038898 14:71254630-71254652 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1119300268 14:73566360-73566382 GGGACTGGGCTCCGTGGAGCAGG + Intergenic
1119486836 14:74994482-74994504 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1119673397 14:76536778-76536800 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1119870652 14:78014007-78014029 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1120215682 14:81679216-81679238 GGGACTGGGCGCTGCGGAGCAGG + Intergenic
1120331034 14:83092717-83092739 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1120429699 14:84399414-84399436 GGGACTGGGCGCCGTGGAACCGG + Intergenic
1120439056 14:84512936-84512958 GGGACTGGGCGCCGTGCAGCAGG + Intergenic
1120704702 14:87734758-87734780 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1120844217 14:89111981-89112003 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1120871304 14:89339613-89339635 GATCCTGCCCGCAGTAGAGCAGG - Intronic
1121350606 14:93170144-93170166 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1121824315 14:96998294-96998316 GGGACTGGGAGGAGTTGAGCTGG - Intergenic
1122143123 14:99674155-99674177 GGGACTGGCTGAAGTGGGGCGGG + Intronic
1122493403 14:102135538-102135560 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1122541531 14:102500352-102500374 GGGAATGGCCGCTCCAGAGCTGG + Exonic
1123030836 14:105450341-105450363 GGGACTGGCTGCGGCAGACCAGG - Intronic
1123051945 14:105548178-105548200 GGGACCAGACGCAGTGGAGCAGG - Intergenic
1123799195 15:23803247-23803269 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1123949076 15:25253220-25253242 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1124036410 15:26057206-26057228 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1124114798 15:26831206-26831228 GGGACTGCGCGCCGTGGAGCAGG + Intronic
1124387807 15:29224820-29224842 GGGACTGGGCACCGTGGAGCAGG + Intronic
1124573183 15:30884090-30884112 GGGACTGGGAGCCGTGGAGCAGG - Intergenic
1125112271 15:36047287-36047309 GGGACTGGGGGCCGTGGAGCAGG - Intergenic
1125480235 15:40074800-40074822 GGGACTGGGCGCCGTGGAGAAGG + Intergenic
1125538953 15:40458888-40458910 GGCACCCGCCGCAGTCGAGCAGG + Exonic
1125565701 15:40676954-40676976 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1125609751 15:40961951-40961973 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1125631640 15:41151972-41151994 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1125725107 15:41864165-41864187 GGGACCTGCCGCAGTAGAGGAGG - Intronic
1126128135 15:45314426-45314448 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1126639726 15:50812302-50812324 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1127211651 15:56779980-56780002 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1127984833 15:64061219-64061241 GGGACTGGGCTCTGTGGAGCAGG - Intronic
1128073774 15:64813396-64813418 GCCACTGGCAGGAGTAGAGCTGG - Intergenic
1128110897 15:65075358-65075380 GGGACTGGGCACCGTGGAGCAGG - Intronic
1128141003 15:65301093-65301115 GGGACTGGGCGCGGTGGAACAGG + Intergenic
1128594058 15:68928981-68929003 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1128598519 15:68975696-68975718 GGGACTGGGCGCCGTGGAGTAGG + Intronic
1128669929 15:69567385-69567407 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1129158216 15:73732212-73732234 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1129280343 15:74480372-74480394 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1129777449 15:78246164-78246186 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1129859221 15:78847207-78847229 GGGACTGGGCGCGGTGGAGCAGG - Intronic
1129986945 15:79926408-79926430 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1130132919 15:81158955-81158977 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1131250298 15:90825807-90825829 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1131846059 15:96491860-96491882 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1131992337 15:98104292-98104314 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1132044258 15:98550046-98550068 GGGCCTGGGCGCTGTGGAGCAGG - Intergenic
1132097749 15:99000336-99000358 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1132155791 15:99494704-99494726 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1133367480 16:5222037-5222059 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1134523820 16:14929992-14930014 GGGCCTGGCCGGAGAGGAGCTGG + Intronic
1134531765 16:14989407-14989429 GGGACCGGCCTGAGTAGAGGAGG + Intronic
1134549083 16:15130943-15130965 GGGCCTGGCCGGAGAGGAGCTGG - Intronic
1134678094 16:16104695-16104717 GGGACTGGGCGCCATGGAGCAGG + Intronic
1134711411 16:16328477-16328499 GGGCCTGGCCGGAGAGGAGCTGG + Intergenic
1134719262 16:16371776-16371798 GGGCCTGGCCGGAGAGGAGCTGG + Intergenic
1134948164 16:18340109-18340131 GGGCCTGGCCGGAGAGGAGCTGG - Intergenic
1134955418 16:18380216-18380238 GGGCCTGGCCGGAGAGGAGCTGG - Intergenic
1135262071 16:20989669-20989691 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1135280908 16:21152931-21152953 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1135751009 16:25058937-25058959 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1135942648 16:26836125-26836147 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1136163349 16:28435702-28435724 GGGACTGGGCGCCGAGGAGCGGG - Intergenic
1136199614 16:28679285-28679307 GGGACTGGGCGCCGAGGAGCGGG + Intergenic
1136215960 16:28793458-28793480 GGGACTGGGCGCCGAGGAGCGGG + Intergenic
1136277566 16:29187851-29187873 GGCACTGGCCCCAGTGGATCAGG + Intergenic
1137442562 16:48509021-48509043 GGGACTGGGCACTGTGGAGCAGG - Intergenic
1137878565 16:52021815-52021837 GGGACTGGCCGCAGGTGACCAGG - Intronic
1139125488 16:64072355-64072377 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1139147791 16:64344227-64344249 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1139442359 16:66974562-66974584 GGGACTGGGCGCTGTGGAGCAGG - Exonic
1139600336 16:67982556-67982578 GGGACTGGGCGCCGTGGAACAGG - Intergenic
1139603109 16:67998549-67998571 GGGACTGGGCGCTGTGGAGCAGG - Intronic
1139919536 16:70450822-70450844 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1140722466 16:77784411-77784433 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1141465692 16:84204642-84204664 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1142505721 17:361927-361949 GGGACTGGGCGCTGTGGAGCAGG - Intronic
1142828766 17:2532158-2532180 GGGATTGGGCGCTGTGGAGCAGG + Intergenic
1143283415 17:5771550-5771572 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
1143552780 17:7641170-7641192 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1143664224 17:8347145-8347167 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1144128136 17:12221197-12221219 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1144467203 17:15506022-15506044 GGAACTGGGCGCTGTGGAGCAGG - Intronic
1144723261 17:17486687-17486709 GGGACTGGGCGCCCTGGAGCAGG - Intronic
1144804624 17:17956523-17956545 GGGACCGGGCGCAGTGGAGCAGG + Intronic
1145050245 17:19654339-19654361 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1145094888 17:20016758-20016780 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1145795822 17:27654837-27654859 GGGACTCCCGGCAGTAGTGCTGG - Intergenic
1146371555 17:32267742-32267764 GGGACTGGCCACAGGAGAGCAGG - Intronic
1146740410 17:35278941-35278963 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1147373676 17:40011267-40011289 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1147997586 17:44369137-44369159 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1148023423 17:44568518-44568540 GGGACTGGGCGCCCTAGAGCAGG - Intergenic
1149099208 17:52884002-52884024 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150682559 17:67295044-67295066 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1150786705 17:68169385-68169407 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1150788326 17:68180186-68180208 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
1150792282 17:68208147-68208169 GGGACTGGGCGCCGTGGGGCAGG - Intergenic
1150804557 17:68308939-68308961 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1151438453 17:74113336-74113358 GGGACTGGGCGCAGCGGAGCAGG + Intergenic
1151782622 17:76257674-76257696 GGGACTGGGGGCTGTGGAGCAGG + Intergenic
1152550731 17:81028683-81028705 TGGACTGCCCGCAGTGGAGCTGG - Intergenic
1152618991 17:81352060-81352082 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1152938777 17:83154925-83154947 GGGTCTGTCAGGAGTAGAGCTGG - Intergenic
1153070434 18:1098565-1098587 GGGACCGGGCGCTGTGGAGCGGG - Intergenic
1153644002 18:7178693-7178715 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1153832410 18:8935450-8935472 GGGACTGGGCGCCGTGGAGCGGG + Intergenic
1155207993 18:23577656-23577678 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1155271903 18:24149580-24149602 GGGACTGGGTGCTGTGGAGCAGG + Intronic
1155294982 18:24376606-24376628 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1155772927 18:29723851-29723873 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1155856326 18:30839185-30839207 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1155976824 18:32140156-32140178 GGGACTGGGTGCCGTGGAGCAGG - Intronic
1156038724 18:32794908-32794930 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1156610451 18:38718451-38718473 GGGACAGGGCGCCGTGGAGCAGG + Intergenic
1156629004 18:38944434-38944456 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1156863708 18:41866091-41866113 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1156943220 18:42795565-42795587 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1157086022 18:44581067-44581089 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1157979747 18:52366930-52366952 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1158047079 18:53169183-53169205 GGGACTGATCTCAGTAAAGCAGG + Intronic
1158351975 18:56572624-56572646 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1158387849 18:57014959-57014981 GGTCCTGGCCTCAGTAGAGATGG - Intronic
1158460687 18:57643686-57643708 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1158697207 18:59714119-59714141 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1158705700 18:59790478-59790500 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1159230855 18:65605587-65605609 GGGACTGGGCGCCGTGGAGCGGG - Intergenic
1159472890 18:68880022-68880044 GGGATTGGGCGCTGTGGAGCAGG + Intronic
1159656051 18:71031364-71031386 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1159818879 18:73114351-73114373 GGGACAGGCTGCAGTACAGCAGG + Intergenic
1160176564 18:76600157-76600179 GGGACTGGGCCCCGTGGAGCAGG + Intergenic
1160198610 18:76777578-76777600 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1160973448 19:1780511-1780533 GGGACAGGCCCCAGTAGGGGGGG + Exonic
1162230199 19:9259847-9259869 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1162526253 19:11208652-11208674 GGGACTGGGTGCAGGAGAGGGGG - Intronic
1162632651 19:11941322-11941344 GGGACTGGGTGCTGTGGAGCAGG + Intronic
1162814673 19:13186731-13186753 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1163181672 19:15608672-15608694 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1163218903 19:15900017-15900039 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1164143981 19:22499015-22499037 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1164270539 19:23668554-23668576 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1164310512 19:24041648-24041670 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1165255781 19:34576668-34576690 GGGACTGACCCCAGAAGGGCGGG - Intergenic
1165266972 19:34668479-34668501 GGGACTGGGCGCTATGGAGCAGG - Intronic
1166486961 19:43221948-43221970 GGGACTGGGTGCTGTGGAGCAGG + Intronic
1166649680 19:44563268-44563290 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
925088646 2:1134751-1134773 GGGACTGGGCACGGTGGAGCAGG + Intronic
925098922 2:1229625-1229647 GGAACTGGGCGCTGTGGAGCAGG + Intronic
926616580 2:15002561-15002583 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
926685791 2:15696801-15696823 GGGACTGGGCGCCCTGGAGCAGG + Intronic
926850700 2:17193845-17193867 GGGACTGGGAGCCGTGGAGCAGG - Intergenic
927054764 2:19358083-19358105 CGGGCTGGCCGCAGTAGCGGAGG + Intronic
927777844 2:25915795-25915817 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
927942144 2:27111540-27111562 GGGACAGGGCGCCGTGGAGCAGG + Intronic
928102451 2:28447158-28447180 GGGACTTGACCCAGGAGAGCTGG + Intergenic
928493117 2:31803974-31803996 GGGACTGGGCACCGTGGAGCAGG - Intergenic
928617891 2:33057453-33057475 GGGACTGGGCGCCGTGGAGCAGG + Intronic
928723067 2:34142561-34142583 GGGACCGGGCGCTGTGGAGCAGG + Intergenic
928753248 2:34494627-34494649 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
928880628 2:36092573-36092595 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
928936952 2:36688594-36688616 GGGACTGGGCACCGTGGAGCAGG - Intergenic
929201909 2:39244609-39244631 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
929379740 2:41335924-41335946 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
929890815 2:45917697-45917719 GGGACTGGGCGCCGTGGAGCAGG + Intronic
930420829 2:51151641-51151663 GGGACTGGGCACCGTGGAGCAGG + Intergenic
930468179 2:51780362-51780384 GGGACTGGGCGCCGTGGAGCTGG + Intergenic
930593444 2:53356764-53356786 GGGACTGGGCACCGTGGAGCAGG - Intergenic
931708741 2:64969338-64969360 GGGACTGGGCGCCGTGGAGCGGG - Intergenic
932178331 2:69622374-69622396 GGGACCGGGCGCTGTGGAGCAGG - Intronic
932239983 2:70148639-70148661 GGGACTGGGCACTGTGGAGCAGG - Intergenic
932359469 2:71092514-71092536 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
932486532 2:72087215-72087237 GGGACTGGGCGCCGTGGAGTAGG - Intergenic
932902099 2:75711908-75711930 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
933442046 2:82326313-82326335 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
933487201 2:82938469-82938491 GGGACTGGATGCCGTGGAGCAGG + Intergenic
933712108 2:85334440-85334462 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
933812081 2:86039066-86039088 AGGAGTGGCCTCAGCAGAGCGGG + Intronic
934227748 2:90148814-90148836 GGGCCTGGCCGAAGTAGTGTGGG + Intergenic
934898547 2:98139336-98139358 GGGACTGGGCACCGTGGAGCAGG - Intronic
936172660 2:110190259-110190281 GGGACTGGGCACTGTGGAGCAGG + Intronic
936346941 2:111682184-111682206 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
936556145 2:113499971-113499993 GGGACTGGCTGCGGCAGGGCAGG - Exonic
937181188 2:119997321-119997343 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
937209543 2:120259777-120259799 GGGACTGGGCGCCGTGGAGCAGG + Intronic
937746649 2:125422582-125422604 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
938126025 2:128672149-128672171 GGGACTGGGCACCGTGGAGCAGG + Intergenic
938725977 2:134109373-134109395 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
939053163 2:137331634-137331656 GGGACTGGGCGCTGTGGAGCAGG + Intronic
939159731 2:138573837-138573859 GGGACTGGCTGCAGCAGAGGAGG - Intergenic
939281803 2:140074113-140074135 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
939738721 2:145880930-145880952 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
939777307 2:146403718-146403740 GGGACTGGGCACCGTGGAGCAGG + Intergenic
940112607 2:150171127-150171149 GGGACTGGGCGCTGTGGAGCTGG + Intergenic
940145609 2:150542349-150542371 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
941240137 2:163026609-163026631 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
941309838 2:163913951-163913973 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
941397880 2:164994781-164994803 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
941476537 2:165957090-165957112 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
941705819 2:168657465-168657487 GGGACTGGGCGCCGTGGAGCAGG + Intronic
941712070 2:168724924-168724946 GGGACTGGGCGCCGTGGAGCAGG + Intronic
941928013 2:170915396-170915418 GGGACTGGGCGCTGCAGAGCAGG + Intergenic
942540240 2:177008184-177008206 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
942867340 2:180691721-180691743 GGGACTGGGCACCGTGGAGCAGG - Intergenic
943024258 2:182608731-182608753 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
943106109 2:183546705-183546727 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
943494698 2:188606421-188606443 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
943680287 2:190760981-190761003 GGGACTGGGCGCCATGGAGCAGG + Intergenic
943790081 2:191921921-191921943 GGGACTGGGCGCCATGGAGCAGG - Intergenic
943835210 2:192508302-192508324 GGGACTGGGCGCCATGGAGCAGG - Intergenic
943906074 2:193502492-193502514 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
943955005 2:194176698-194176720 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
944055223 2:195515961-195515983 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
944228488 2:197370901-197370923 GGGACTGGGCGCCGTGGAGCGGG - Intergenic
944728658 2:202497243-202497265 GGGACTGGGCGCCGTGGAGCAGG - Intronic
944729691 2:202503704-202503726 GGGACTGGGCGCCGTGGAGCAGG - Intronic
944843092 2:203642895-203642917 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
944857880 2:203785601-203785623 GGGACTGGGCACCGTGGAGCAGG + Intergenic
944929013 2:204497074-204497096 GGCACTGCACACAGTAGAGCAGG + Intergenic
945069681 2:205977518-205977540 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
945451446 2:210000643-210000665 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
945575423 2:211524404-211524426 GGGACTGGGTGCCGTGGAGCAGG + Intronic
945745833 2:213718825-213718847 GGGACTGGGCGCCGTGGAGTAGG - Intronic
946181875 2:217953774-217953796 GGCACTGGCCTCTTTAGAGCTGG - Intronic
946358032 2:219201454-219201476 GGGACTGGGCGCTGTGGAGCAGG + Intronic
946923512 2:224603728-224603750 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
946982112 2:225229475-225229497 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
947026685 2:225744467-225744489 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
947720477 2:232366674-232366696 GGGACTGGGCGCCATGGAGCAGG - Intergenic
947932005 2:233972495-233972517 GGGACTGGGCGCCATGGAGCAGG + Intronic
948460719 2:238128742-238128764 TGGCCTGGCCGCACTACAGCTGG + Exonic
948468747 2:238164322-238164344 GGGACTGGATGCAGATGAGCAGG - Exonic
1168913202 20:1466600-1466622 GGGTCGGGCCGCGGTAGAGCGGG + Intronic
1169814403 20:9641616-9641638 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1169849242 20:10032012-10032034 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1170230829 20:14044855-14044877 GGGACTGGGTGCCGTAGAGCAGG + Intronic
1170246522 20:14226840-14226862 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1170451918 20:16491741-16491763 GGCACTGACTGCAGCAGAGCTGG - Intronic
1170649551 20:18227098-18227120 GGGACTGGGCGCTGTGGAGCGGG - Intergenic
1173195477 20:40910496-40910518 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1173601648 20:44299468-44299490 GGGACTGGGCGCCGTGGAGTAGG - Intergenic
1174053260 20:47781855-47781877 GGGACTGCCCGCCCCAGAGCTGG + Intronic
1174122829 20:48279729-48279751 GGGACTGGCCGGGGTAGACTGGG - Intergenic
1175210119 20:57348731-57348753 GGGACTGGGCGCCGTGGAGCGGG - Intergenic
1176332250 21:5559678-5559700 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1176395507 21:6261273-6261295 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1176441650 21:6727831-6727853 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1176465912 21:7054900-7054922 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1176489473 21:7436678-7436700 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1176663678 21:9664097-9664119 GGGACTGGGAGCTGTGGAGCAGG + Intergenic
1176671087 21:9735870-9735892 GAGACTGGGCGCTGTGGAGCAGG - Intergenic
1176966563 21:15218602-15218624 GGGACTGGGCGCAGTGGAGTAGG + Intergenic
1177182336 21:17757614-17757636 GGGACTGGGCACTGTGGAGCAGG + Intergenic
1177318764 21:19493876-19493898 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1177496985 21:21902758-21902780 GGGACTGGGCCCCGTGGAGCAGG - Intergenic
1177637668 21:23807349-23807371 GGGACTGGGCGCTGTGGAGTAGG - Intergenic
1177795945 21:25778650-25778672 GGGCCTGGGCGCCGTGGAGCAGG - Intergenic
1178327044 21:31654519-31654541 GGGACTGGGCGCCGTAGAGCAGG - Intergenic
1178398795 21:32265665-32265687 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1178585593 21:33868344-33868366 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1178610420 21:34074107-34074129 GGGACGGGCCGGAGTCGGGCTGG - Intronic
1178983299 21:37283212-37283234 AGGACTGGCCGTGGTGGAGCAGG + Intergenic
1180740987 22:18053383-18053405 GGGACTGGGCGCCATCGAGCAGG + Intergenic
1181077625 22:20392437-20392459 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1181450495 22:23017079-23017101 GGGACTGGGCGCGGTGGAGCAGG + Intergenic
1181457839 22:23069962-23069984 GGGACTGGCTGCAGTAAAGAGGG + Intronic
1181800842 22:25346955-25346977 GGGACTGGGCACCGCAGAGCAGG + Intergenic
1182092106 22:27602834-27602856 GGGAGTGGCGGCAGTAGGGTGGG + Intergenic
1182337988 22:29598092-29598114 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1183058011 22:35318860-35318882 TGCACTGGCCGCGGGAGAGCTGG - Intronic
1183422067 22:37717867-37717889 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1183685290 22:39357933-39357955 GGGACTAGGCGCCGTGGAGCAGG - Intronic
1183990406 22:41593852-41593874 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1184097992 22:42326889-42326911 GTGAGTGGCCGCTGCAGAGCAGG - Intronic
1184906196 22:47488333-47488355 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1185192791 22:49449591-49449613 GGGGCTGCCCTCAGGAGAGCGGG + Intronic
1185216206 22:49601270-49601292 GGGTCTGGGGGCAGCAGAGCCGG + Intronic
1185229066 22:49670228-49670250 GGGACTGGGCGCCGCGGAGCAGG + Intergenic
949259030 3:2083961-2083983 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
950068907 3:10136462-10136484 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
950203649 3:11061706-11061728 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
950256910 3:11513272-11513294 GAGACTGGGCGCCGTGGAGCAGG + Intronic
950400919 3:12768820-12768842 GGGACCGGGCGCCGTGGAGCAGG + Intronic
950418597 3:12883182-12883204 GGGACTGGGCGCGGTGGAGCAGG - Intergenic
950470212 3:13180050-13180072 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
950513314 3:13447223-13447245 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
950600330 3:14029522-14029544 GGGACTGGGCACCGTGGAGCAGG + Intronic
950601284 3:14037539-14037561 GGGACTGGGCACTGCAGAGCAGG - Intronic
950929446 3:16774050-16774072 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
951146543 3:19234311-19234333 GGGACTGGGCGCCGTTGAGCAGG + Intronic
951332903 3:21387278-21387300 GGGACTGCACGCCGTGGAGCAGG + Intergenic
951335895 3:21421263-21421285 GGAGCTGGCCGCAGGAGTGCCGG + Exonic
951491181 3:23272055-23272077 GGGACTGGGTGCCGTGGAGCAGG + Intronic
951951034 3:28200440-28200462 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
952138150 3:30446960-30446982 GGTACTGGCAGTAGAAGAGCAGG - Intergenic
952360523 3:32625968-32625990 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
952393764 3:32903127-32903149 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
952398284 3:32940016-32940038 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
952593692 3:34988711-34988733 GGGACTGGGCGTCGTGGAGCAGG - Intergenic
952713363 3:36453636-36453658 GGGATTGGGCGCCGTGGAGCAGG - Intronic
952795301 3:37233352-37233374 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
953089883 3:39713649-39713671 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
953124459 3:40077954-40077976 GGGACTGGGCGCCGTGGAGCAGG + Intronic
953522442 3:43656453-43656475 GGGACTGGGCGCCATGGAGCAGG + Intronic
953674019 3:44986143-44986165 GGGACTGGGCGCCGTGGAGCAGG + Intronic
954041056 3:47887539-47887561 GGGACTGGGCGCCGTGGAGCAGG - Intronic
954620187 3:51990906-51990928 GGGACTGGGTGCCGTGGAGCGGG - Intergenic
955183406 3:56692214-56692236 GGAACTGGGCGCCGTGGAGCAGG - Intergenic
955186478 3:56719266-56719288 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
955210340 3:56934799-56934821 GGGACTGGGTGCAGTGGAGCAGG - Intronic
955266407 3:57449372-57449394 GGGACTGGGCGCCATGGAGCAGG + Intronic
955449533 3:59051191-59051213 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
956195787 3:66651861-66651883 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
956481509 3:69677787-69677809 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
956541684 3:70347427-70347449 GGAACTGGCCTAAGTAGAGAAGG + Intergenic
956632649 3:71331431-71331453 GGGACTGGGTGCCGTGGAGCAGG - Intronic
957002219 3:74900003-74900025 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
957056119 3:75444461-75444483 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
957074130 3:75588088-75588110 GGGACTGGGCGCCATGGAGCAGG - Intergenic
957362132 3:79173656-79173678 GGGACTGGGCACCGTGGAGCAGG - Intronic
957371537 3:79300553-79300575 GGGACTGGGCGCCATGGAGCGGG - Intronic
957386494 3:79502555-79502577 GGGACTGGGAGCTGTGGAGCAGG - Intronic
957419612 3:79951397-79951419 GGGACTGGGCACCGTGGAGCAGG + Intergenic
957446171 3:80314782-80314804 GGGACTGAGCGCTGTGGAGCAGG - Intergenic
957630991 3:82715660-82715682 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
957804852 3:85133887-85133909 GGGACTGGGCGCCGTGGAGCAGG + Intronic
957829959 3:85504702-85504724 GGGACTGGGCTCCGTGGAGCAGG + Intronic
957919628 3:86731537-86731559 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
957995160 3:87679432-87679454 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
958419924 3:93917918-93917940 GGGACTGGGCGCCCTGGAGCAGG - Intronic
958740771 3:98068235-98068257 GTGACTGGCTGCTATAGAGCTGG + Intergenic
959422791 3:106148967-106148989 GGGACTGGTCGCCATGGAGCAGG - Intergenic
960149747 3:114238316-114238338 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
960227482 3:115184914-115184936 GGGACTGGACGCCCTGGAGCAGG + Intergenic
960487361 3:118269998-118270020 GGGACTGGGCGCCATGGAGCAGG - Intergenic
960669258 3:120140582-120140604 GGGACCGGGCGCCGCAGAGCAGG - Intergenic
960950017 3:122993167-122993189 TGGTCTGGCCGCAGAAAAGCAGG + Intronic
961298270 3:125904226-125904248 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
961465002 3:127076311-127076333 GGGACTGGGCACCGTGGAGCAGG + Intergenic
961688859 3:128653732-128653754 GGGACTGGGCGCCTTGGAGCAGG - Intronic
961874434 3:130010927-130010949 GGGACTGGGCGCTATGGAGCAGG - Intergenic
962283697 3:134070287-134070309 GGGACTGGGCGCCGTGGAGCAGG + Intronic
962398699 3:135039453-135039475 GGGACTGGGCGCCGTGGAGTAGG + Intronic
962417986 3:135201211-135201233 TGGACTGGCGGCAGTGGAGATGG + Intronic
962600447 3:136987614-136987636 GGGACTGGGCGCCGTGGAGCAGG + Intronic
962758304 3:138484983-138485005 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
962998184 3:140651725-140651747 GGGACTGGACCCTGTGGAGCAGG - Intergenic
963509103 3:146225458-146225480 GGGACTGGGTGCGGTGGAGCAGG + Intronic
963583391 3:147154402-147154424 GGGACCGGGCGCTGTGGAGCAGG - Intergenic
963589938 3:147245635-147245657 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
963673461 3:148280592-148280614 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
963760641 3:149284320-149284342 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
964014438 3:151928490-151928512 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
964032376 3:152152752-152152774 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
964037591 3:152217635-152217657 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
964117920 3:153155775-153155797 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
964198195 3:154088305-154088327 GGGACTGGGCACCGTGGAGCAGG - Intergenic
964375099 3:156041611-156041633 GGGACTGGGCGCCGTGGAGCAGG - Intronic
964378565 3:156073450-156073472 GGGACTGGGCACCGTGGAGCAGG - Intronic
964381143 3:156099758-156099780 GGGACTGGGCACCGTGGAGCAGG - Intronic
964802843 3:160574015-160574037 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
965003573 3:162987654-162987676 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
965040351 3:163499358-163499380 GGGACTGGGCGCCGTGAAGCGGG - Intergenic
965044085 3:163552348-163552370 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
965109370 3:164401916-164401938 GGGACTGGGCACCGTGGAGCAGG + Intergenic
965200293 3:165649343-165649365 GGGACTGGGCGCCATGGAGCAGG + Intergenic
965220846 3:165924363-165924385 GGGACTGGGTGCGGTGGAGCAGG + Intergenic
965288096 3:166843146-166843168 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
966076117 3:175937706-175937728 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
966096732 3:176213442-176213464 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
966182978 3:177203901-177203923 GGGACCGGGCGCCGCAGAGCAGG + Intergenic
966190962 3:177271755-177271777 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
966372376 3:179263079-179263101 GGGACTGGGTGCCGTGGAGCAGG + Intronic
966442669 3:179963763-179963785 GGAGCTGGCCCCAGTAGAGGTGG - Intronic
966548924 3:181183057-181183079 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
966725058 3:183101231-183101253 GGGACTGGGCGCCGTGGAGCAGG - Intronic
966725377 3:183103773-183103795 GGGACTGGGCGCTGTGGAGCAGG + Intronic
967448556 3:189596458-189596480 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
967499100 3:190177075-190177097 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
967718408 3:192789366-192789388 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
968412759 4:404026-404048 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
968716214 4:2161601-2161623 GGGACTGGGCGCCATGGAGCAGG - Intronic
968804390 4:2763151-2763173 GGGACTAGGCGCCGTGGAGCGGG + Intergenic
968954841 4:3712983-3713005 GGGACTGGCCGGGGCAGAGGGGG - Intergenic
968998926 4:3964742-3964764 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
969017749 4:4115688-4115710 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
969362408 4:6673058-6673080 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
969440793 4:7215463-7215485 GGGACTGGGAGCCGTGGAGCAGG - Intronic
969654923 4:8491436-8491458 GGGACTGGGTGCCGTGGAGCAGG + Intronic
969736243 4:8992924-8992946 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
970182645 4:13415717-13415739 GGGACCGGGCGCCGTAGAGCAGG - Intronic
970391269 4:15615248-15615270 GGGACTGGGTGCCGTGGAGCAGG - Intronic
970576816 4:17436589-17436611 GGGACTGGGCGCTGTGGAGAAGG + Intergenic
970649273 4:18159296-18159318 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
970803581 4:20004349-20004371 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
971043299 4:22778634-22778656 GGGACTGGGCGCCATGGAGCAGG + Intergenic
971377055 4:26063996-26064018 GGGACTGGGCGCCGTGCAGCAGG + Intergenic
971552985 4:27978361-27978383 AGGACTGGGCGCCGTGGAGCAGG + Intergenic
971563615 4:28113112-28113134 GGGACTGAGCGCCGTGGAGCAGG - Intergenic
971639875 4:29117688-29117710 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
971709516 4:30093040-30093062 GGGACTAGGCGCCGTGGAGCAGG - Intergenic
971812006 4:31438986-31439008 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
972022736 4:34335667-34335689 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
972034749 4:34506647-34506669 AGGACTGGGCGCTGTGGAGCAGG + Intergenic
972392606 4:38627237-38627259 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
972774315 4:42227434-42227456 GGGACTTACCGCAGAGGAGCTGG - Intergenic
972900181 4:43672692-43672714 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
973144215 4:46804856-46804878 GGGACTGGGCACCGTGGAGCAGG + Intronic
973190259 4:47378069-47378091 GGGACTGGGCGCCGTAGAGCAGG + Intronic
973308131 4:48675675-48675697 GGGACTGGGCACCGTGGAGCAGG - Intronic
973587709 4:52409772-52409794 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
973817640 4:54632870-54632892 GGGACTGGGAGCCGTGGAGCAGG - Intergenic
974147473 4:57965759-57965781 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
974781692 4:66561518-66561540 GGGATTGGGCGCCGTGGAGCAGG + Intergenic
974792715 4:66712443-66712465 GGGACTGGGCGCTGTACAGCAGG + Intergenic
974804438 4:66860503-66860525 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
974827813 4:67152214-67152236 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
974838184 4:67275276-67275298 GGGACTGGGCACTGTGGAGCAGG + Intergenic
974992818 4:69115270-69115292 GGGACTGGGCGCCCTTGAGCAGG + Intronic
975055453 4:69924225-69924247 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
975298860 4:72766190-72766212 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
975439897 4:74399090-74399112 GGGACTGGGCGCCATGGAGCAGG + Intergenic
975595135 4:76043321-76043343 GGGACTGGGCACCGTGGAGCAGG + Intronic
975596313 4:76050683-76050705 GGGACTGGGCACCGTGGAGCAGG + Intronic
975755919 4:77570997-77571019 GGGACTGGGCACCGTGGAGCAGG - Intronic
976213172 4:82692226-82692248 GGCAGTGGTTGCAGTAGAGCTGG - Intronic
976406433 4:84665025-84665047 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
976520576 4:86021633-86021655 GGGACTGGGCGCCATGGAGCAGG + Intronic
976565576 4:86547589-86547611 GGGACTGGGTGCTGTGGAGCAGG - Intronic
976646816 4:87395972-87395994 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
976690545 4:87863696-87863718 GGGACCGGGCGCTGCAGAGCAGG + Intergenic
976736251 4:88313229-88313251 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
976846115 4:89490337-89490359 GGGACTGGGTGCCGTGGAGCCGG - Intergenic
976980241 4:91217996-91218018 GGGACTGGGCGCCGTGGAGCAGG + Intronic
977717297 4:100196546-100196568 AGGACTGGGCGCCGTGGAGCAGG + Intergenic
978080304 4:104582315-104582337 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
978241834 4:106525371-106525393 GGGGCTGGGCGCCGTGGAGCAGG + Intergenic
978463571 4:108984417-108984439 GGGACTGGGCGCCCTAGAGCGGG + Intronic
978809146 4:112831140-112831162 GGGACTGGGCGCTGCAGAGTAGG - Intronic
978999526 4:115200220-115200242 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
979033174 4:115678527-115678549 GGGACCGGGCGCCGCAGAGCAGG + Intergenic
979224244 4:118265888-118265910 GGGACTGGGCGCGGTGGAGCAGG - Intergenic
979290763 4:118977076-118977098 GGGACTGGGCGCCGTGGAGCAGG + Intronic
979308375 4:119174120-119174142 GGGACTGGGCGCAGTGGAGCAGG - Intronic
979424698 4:120550763-120550785 GGGACTAGGCACAGTGGAGCAGG + Intergenic
979688645 4:123538251-123538273 GGGACTGGGCACCGTGGAGCAGG - Intergenic
979755918 4:124339346-124339368 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
979822602 4:125192237-125192259 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
979829417 4:125281309-125281331 GGGACTGGGCACCGTGGAGCAGG - Intergenic
979857462 4:125651789-125651811 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
979865270 4:125745322-125745344 GGGACTAGGCGCTGCAGAGCAGG - Intergenic
979899654 4:126201317-126201339 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
980115258 4:128672953-128672975 GGGACTGGGCGCCATGGAGCAGG - Intergenic
980228036 4:130013114-130013136 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
980230203 4:130038572-130038594 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
980381534 4:132026251-132026273 GGGAGTGGCCACAGCAGAGACGG - Intergenic
980470175 4:133240433-133240455 GGGACTGGGCACCGTGGAGCAGG + Intergenic
980563065 4:134502130-134502152 GGGACTGGGCGCTGCAGAGCAGG - Intergenic
980628647 4:135406953-135406975 GGGACTGGGCCCTGTGGAGCAGG - Intergenic
980698797 4:136395651-136395673 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
980815611 4:137942405-137942427 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
980913156 4:139011409-139011431 GGGAGTGGCCGCAGGTGAGGTGG - Intergenic
981146670 4:141333044-141333066 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
981169516 4:141605458-141605480 GGGACTGGGCGCTTTGGAGCAGG + Intergenic
981176536 4:141689884-141689906 GGGACTGGGCGCCGTGGAGCAGG + Intronic
981275868 4:142897831-142897853 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
982728241 4:158928036-158928058 GGGACTGGGCACCGTGGAGCAGG - Intronic
982814528 4:159869058-159869080 GGGACTGGGCTCCGTGGAGCAGG + Intergenic
982863445 4:160482103-160482125 GGAACTGGGCGCCGTGGAGCAGG - Intergenic
982868748 4:160550133-160550155 GGGACTAGGCGCTGTGGAGCAGG + Intergenic
983060389 4:163153180-163153202 GGGACTCGGCGCCGTGGAGCAGG - Intronic
983553002 4:169035861-169035883 GGGACTGGGCGCCATGGAGCAGG + Intergenic
983835341 4:172377563-172377585 GGGACTGGGTGCCGTGGAGCAGG + Intronic
984192782 4:176625191-176625213 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
984238765 4:177193222-177193244 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
984241789 4:177227591-177227613 GGGACTGGGCACTGTGGAGCAGG + Intergenic
984265714 4:177495926-177495948 GGGACTGGGCACCGTGGAGCAGG - Intergenic
984662302 4:182386884-182386906 GGGACTGGGCGCCGTGGAACAGG - Intronic
984901795 4:184592200-184592222 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
984908301 4:184649524-184649546 GGGACGGGCCGCAGCGGAGGCGG - Intergenic
984918158 4:184741538-184741560 GGGACTGGGCGCCACAGAGCAGG - Intergenic
984948663 4:184990113-184990135 GGGACTGGGCACCGTGGAGCAGG + Intergenic
985087153 4:186324918-186324940 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
985195060 4:187420648-187420670 GGGACTGGGCGCCATGGAGCAGG + Intergenic
985366451 4:189236640-189236662 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
985403817 4:189616672-189616694 GGGACTGGGCGCCATGGAGCAGG + Intergenic
985409121 4:189664765-189664787 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
986121189 5:4837868-4837890 GGGATTGGGCGCCGTGGAGCAGG - Intergenic
986152057 5:5138120-5138142 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
986336289 5:6758355-6758377 GGGGCTGGCAGGAGTTGAGCAGG + Intergenic
986626228 5:9725662-9725684 GGGGCTGGGCGCCGTGGAGCAGG - Intergenic
986912330 5:12573970-12573992 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
986993324 5:13578806-13578828 GGGACTGGGCGCGGTGGAGCAGG - Intergenic
987283784 5:16436515-16436537 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
987315347 5:16718286-16718308 GGGACTGGGCGCCGTGGAGCAGG - Intronic
987347391 5:16991007-16991029 GGGACTGGGCACGGTGGAGCAGG + Intergenic
987352236 5:17032454-17032476 GGCACTGGGCGCTGTGGAGCAGG + Intergenic
987355893 5:17062524-17062546 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
987383956 5:17311799-17311821 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
987476629 5:18399686-18399708 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
987532728 5:19142796-19142818 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
987877003 5:23691459-23691481 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
987896344 5:23951631-23951653 GGGACTGGGCGCCCTGGAGCAGG - Exonic
987990196 5:25200048-25200070 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
988073558 5:26324795-26324817 GGGACTGGGCGCCATGGAGCAGG - Intergenic
988086934 5:26485306-26485328 GGGACTGGACGCCGTGGAGCAGG + Intergenic
988132212 5:27120234-27120256 GGGACTGGGCGCCGTGGAGCAGG - Intronic
988154998 5:27439476-27439498 GGGACTGGGCGCCATGGAGCAGG + Intergenic
988915844 5:35892893-35892915 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
989003253 5:36782915-36782937 GGGACTGGGCACTGTGGAGCAGG - Intergenic
989346849 5:40438994-40439016 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
989559737 5:42836703-42836725 GGGACTGGGTGCCGTGGAGCAGG - Intronic
990323120 5:54649044-54649066 GGGACCGGCCGCTGTGGAGCAGG + Intergenic
990461576 5:56035824-56035846 GGGACTGGGCGCCGTGGAGTAGG - Intergenic
990869521 5:60415750-60415772 GGGACTGGGCGCCCTGGAGCAGG - Intronic
991427132 5:66503569-66503591 GGGACTGGGCGCAGTGGAGCAGG - Intergenic
991567507 5:68020428-68020450 GGGACTGGGCACCGTGGAGCAGG + Intergenic
992048921 5:72925825-72925847 GGGACTGGGCGCCGCGGAGCAGG - Intergenic
992050415 5:72935578-72935600 GGGACTGGGCACCGTGGAGCAGG - Intergenic
992296790 5:75334020-75334042 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
993031926 5:82715024-82715046 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
993320882 5:86466707-86466729 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
993529137 5:89003650-89003672 GGGACTGGGCGCCGTGGAGCGGG + Intergenic
993822091 5:92631666-92631688 GGGACTGGGCACCGTGGAGCAGG - Intergenic
994096394 5:95851501-95851523 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
994230018 5:97301483-97301505 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
994254742 5:97580020-97580042 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
994507170 5:100657097-100657119 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
994570354 5:101506363-101506385 GGGACCGGGCGCTGTGGAGCAGG - Intergenic
994605548 5:101962471-101962493 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
994620400 5:102155275-102155297 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
994647713 5:102491417-102491439 GGGACTGGGCACCGTGGAGCAGG + Intronic
994701647 5:103142060-103142082 GGGACTGGGCGCCGTGGAGCAGG + Intronic
994769734 5:103966351-103966373 GGGACTGGGCGCCGTGGAGCGGG + Intergenic
994841446 5:104929336-104929358 GGGACTGGGCGTTGTAGAGCAGG - Intergenic
994928857 5:106154598-106154620 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
994932391 5:106206115-106206137 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
994935332 5:106246545-106246567 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
995112332 5:108442107-108442129 GGGACTGGGCGCTGTGGAGCGGG + Intergenic
995326368 5:110894053-110894075 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
995568727 5:113457478-113457500 GGGACTGGGTGCCGTGGAGCAGG - Intronic
995656560 5:114433015-114433037 GGGACTGGGCACCGTGGAGCAGG - Intronic
995679818 5:114704314-114704336 GGGACTGGGCGCCGTGGAGTAGG + Intergenic
995920451 5:117304997-117305019 GGGACTGGGCGCCGTGGAGTAGG - Intergenic
996107097 5:119517439-119517461 GGGACTGGGCGCCGTGGAGCAGG - Intronic
996234273 5:121107511-121107533 GGGACTGGGCACGGTGGAGCAGG - Intergenic
996435746 5:123430884-123430906 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
996586035 5:125088989-125089011 GGGACTGGGCACTGTGGAGCAGG - Intergenic
996815617 5:127569747-127569769 GGGACTGGGCGCTGTCGAGCAGG - Intergenic
997352263 5:133239294-133239316 GGGACTGGGCGCCCTGGAGCAGG - Intronic
999348593 5:150845761-150845783 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
999406234 5:151309527-151309549 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
999855230 5:155586778-155586800 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1000066089 5:157694173-157694195 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1000212403 5:159119463-159119485 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1000329134 5:160193922-160193944 GGGACTGGGCGCCGTGGGGCAGG + Intronic
1000432319 5:161166183-161166205 GGGACTGGGCGCTGTGCAGCAGG + Intergenic
1000889278 5:166784567-166784589 GGGACTGGGCGCCGTGGGGCAGG + Intergenic
1000891762 5:166810221-166810243 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1001636499 5:173213766-173213788 GGGACCGGGCGCCGTGGAGCAGG - Intergenic
1002004581 5:176222051-176222073 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1002221796 5:177688569-177688591 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1002906974 6:1456996-1457018 GGGACTGGGCGCCGTAGAGCAGG + Intergenic
1003060778 6:2860475-2860497 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1003100246 6:3171099-3171121 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
1003170795 6:3720790-3720812 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1003176911 6:3758452-3758474 GGGACTGGGCGCCGTAGAGCAGG - Intergenic
1003213788 6:4090425-4090447 GGGACTGGGTGCCGTGGAGCAGG - Intronic
1003284801 6:4725356-4725378 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1003506635 6:6745742-6745764 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1003508783 6:6762506-6762528 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1003578269 6:7316849-7316871 GGGACTGGGCGCTGTGGAGCTGG + Intronic
1003581492 6:7344550-7344572 GGGACTGGGCGCTGTAGAGCAGG - Intronic
1003589649 6:7426072-7426094 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1003671592 6:8164668-8164690 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1003717611 6:8665805-8665827 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1003717756 6:8666303-8666325 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1003736950 6:8887500-8887522 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1003770100 6:9290469-9290491 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1003836162 6:10074735-10074757 GGGACCGGGCGCCGTGGAGCAGG + Intronic
1003845782 6:10172059-10172081 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1003862848 6:10337746-10337768 GGGACTGGGAGCCGTGGAGCAGG - Intergenic
1003908185 6:10720924-10720946 GGGACTGGGCCCTGTGGAGCAGG - Intergenic
1003956731 6:11171399-11171421 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1004053097 6:12108415-12108437 GGGACTGGGCGCCATGGAGCAGG + Intronic
1004200318 6:13541875-13541897 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1004224446 6:13772824-13772846 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1004235492 6:13871947-13871969 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1004248494 6:14002724-14002746 GGGACTGGGAGCCGTGGAGCGGG - Intergenic
1004250364 6:14018331-14018353 GGCACTGGCCGCTGTGAAGCAGG - Intergenic
1004338171 6:14783629-14783651 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1004452337 6:15758783-15758805 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1004499623 6:16198126-16198148 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1004519354 6:16347174-16347196 GGGACTGGGCGCTGTGGAGCAGG - Intronic
1004647959 6:17580954-17580976 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1004665479 6:17745333-17745355 TGGACTGGGCGCCGTGGAGCAGG + Intergenic
1004689041 6:17976213-17976235 GGGACTGGGCGCGGTGGAGAAGG + Intronic
1004905471 6:20233508-20233530 GGGACCGGGCGCTGTGGAGCAGG - Intergenic
1004906259 6:20239351-20239373 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1004906883 6:20244796-20244818 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1004908557 6:20259839-20259861 GGGACTGGGCGCGGTGGAGCAGG - Intergenic
1004912678 6:20301587-20301609 GGGACTTGGCGCCGTGGAGCAGG - Intergenic
1005042220 6:21609925-21609947 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1005059340 6:21761496-21761518 GGGACTGGGCGCCGTGGAGCCGG - Intergenic
1005332827 6:24765961-24765983 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1005596156 6:27381093-27381115 GGGACTGGGCACCGTGGAGCAGG + Intronic
1005600813 6:27424853-27424875 GGGACTGGGCGCCGTGGAACAGG + Intergenic
1005712057 6:28512121-28512143 GGGACTGGGCGGCGTGGAGCAGG - Intronic
1005725013 6:28639810-28639832 AGGACTGGCTGCTGTGGAGCAGG + Intergenic
1005749027 6:28866509-28866531 GGGATTGGGCGCCGTGGAGCAGG + Intergenic
1005749868 6:28872617-28872639 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1005758841 6:28949819-28949841 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1005976953 6:30807467-30807489 GGGACTGGGCGTCGTGGAGCAGG + Intergenic
1005999772 6:30955831-30955853 GGGATTCGGCGCAGTAGGGCTGG - Intergenic
1006005829 6:31000800-31000822 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1006008362 6:31021055-31021077 GGGACTGGGCGCCCTGGAGCAGG - Intronic
1006033689 6:31195796-31195818 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1006128003 6:31852350-31852372 GGGACTGGGGGCCGTGGAGCAGG - Intergenic
1006227013 6:32547949-32547971 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1006352699 6:33532725-33532747 GGGACTGGCCGCCCTGGAGCAGG - Intergenic
1006477886 6:34269361-34269383 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1006696062 6:35931605-35931627 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1006748846 6:36364257-36364279 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1007139115 6:39554067-39554089 GGGCCTGGCTGCAATAGGGCTGG + Intronic
1007263798 6:40582417-40582439 GGGATTGTCTGCAGGAGAGCCGG - Intronic
1007738778 6:43998391-43998413 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1008005537 6:46405792-46405814 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1008038843 6:46774933-46774955 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1008270133 6:49481852-49481874 GGGACTGGGCGCCATGGAGCAGG + Intronic
1008270441 6:49483447-49483469 GGGACTGGGCACTGTGGAGCAGG + Intronic
1008284286 6:49629575-49629597 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1008771051 6:54979571-54979593 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1008844886 6:55950642-55950664 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
1009402645 6:63275009-63275031 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1009407057 6:63326476-63326498 GGGACTGGGCACTGTGGAGCAGG + Intergenic
1009470320 6:64024069-64024091 GGGACTGGGCGCTGTGGAGCAGG - Intronic
1009510758 6:64547751-64547773 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1009587702 6:65627876-65627898 GGGACTGGGCGCCGTAGAGCAGG - Intronic
1009664286 6:66655436-66655458 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1009800766 6:68533725-68533747 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1010066332 6:71686445-71686467 GGGACTGGGCGCTGCGGAGCAGG - Intergenic
1010199260 6:73268899-73268921 GGGACTGGGCGCCATGGAGCAGG + Intronic
1010235591 6:73572561-73572583 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1010617438 6:78030137-78030159 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1011143746 6:84189703-84189725 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1011338304 6:86284844-86284866 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1011601640 6:89065248-89065270 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1011620049 6:89234514-89234536 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1011870031 6:91881919-91881941 GGGACTGGGCGCCGTGAAGCAGG + Intergenic
1012189288 6:96260971-96260993 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1012578178 6:100829257-100829279 GGGACTGGGCACCGTGGAGCAGG + Intronic
1012598437 6:101066696-101066718 GGGACTGGGCACCGCAGAGCAGG + Intergenic
1012733507 6:102910748-102910770 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1012760448 6:103294429-103294451 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1012851038 6:104446622-104446644 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1013081428 6:106816787-106816809 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1013143511 6:107364270-107364292 GGGACTGGGCGCCGTGGAGTAGG + Intronic
1013694758 6:112689392-112689414 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1013955291 6:115834625-115834647 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1013963399 6:115928107-115928129 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1014055940 6:117015088-117015110 GGGACTGGGCTCCGTGGAGCAGG - Intergenic
1014126634 6:117783558-117783580 GGGAAGGGCCCCAGTATAGCAGG + Intergenic
1014240798 6:119015659-119015681 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1014280861 6:119441339-119441361 GGGACTGGGCGCCGTGAAGCAGG - Intergenic
1014460217 6:121686480-121686502 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1014499233 6:122165153-122165175 GGGACTGGGCGCCGTGGAGCGGG + Intergenic
1014507814 6:122280915-122280937 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1014709124 6:124785775-124785797 CGGACTGGCCTCAGTACTGCTGG + Intronic
1014718614 6:124892308-124892330 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1014739054 6:125126189-125126211 GGGAGTGGGCGCTGTGGAGCAGG - Intronic
1014921018 6:127214615-127214637 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1015600402 6:134905065-134905087 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1016092773 6:139999609-139999631 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1016172888 6:141041649-141041671 GGGACTGGGTGCTGCAGAGCAGG + Intergenic
1016482263 6:144495175-144495197 GGGAGTGGGCGCCGTGGAGCAGG + Intronic
1017299036 6:152834679-152834701 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1017325145 6:153133957-153133979 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1017537428 6:155363406-155363428 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1017581160 6:155866780-155866802 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1018064180 6:160114527-160114549 GGGACTGGGCTCCGTGGAGCAGG + Intergenic
1018624591 6:165765312-165765334 GGGACTGGGCGCTGTAGAGCAGG + Intronic
1018696141 6:166393377-166393399 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1018769057 6:166956386-166956408 GGGAATGGCCGCAGCAGCCCTGG + Exonic
1019000208 6:168743809-168743831 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1019025649 6:168960721-168960743 GGCACTAGCCCCAGCAGAGCGGG + Intergenic
1019729778 7:2623504-2623526 GAGACTGGCAGGAGTGGAGCTGG + Intergenic
1019944213 7:4313963-4313985 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1019965702 7:4496956-4496978 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1020288847 7:6706836-6706858 GGGGCTGGGCGCCGAAGAGCCGG - Exonic
1020552229 7:9621508-9621530 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1021324180 7:19245819-19245841 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1021520661 7:21536614-21536636 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1022174095 7:27857081-27857103 GGAACTGGGCGCCGTGGAGCAGG + Intronic
1023127989 7:36974073-36974095 GGGACTGGGCGCAGTGGAACAGG - Intronic
1023378038 7:39577733-39577755 GGGACCGGGCGCAGCAGAGCAGG - Intronic
1024013911 7:45294175-45294197 GGGACTAGCCACAGTAGATCAGG + Intergenic
1024269131 7:47628811-47628833 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1024335582 7:48202939-48202961 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1024465957 7:49711588-49711610 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1024691339 7:51806169-51806191 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1024700581 7:51900910-51900932 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1024735760 7:52302919-52302941 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1024741821 7:52362941-52362963 GGGACTGGGCACTGTGGAGCAGG - Intergenic
1024834100 7:53495356-53495378 GGGACTAGGCGCCGTGGAGCAGG - Intergenic
1025962023 7:66231386-66231408 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1026187038 7:68090439-68090461 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1026203003 7:68231367-68231389 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1026335946 7:69394161-69394183 GGGACTGGACGCCGTGGAGCAGG - Intergenic
1026512396 7:71037929-71037951 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1026596506 7:71738105-71738127 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1027237970 7:76309505-76309527 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1027563988 7:79767990-79768012 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1027579660 7:79977629-79977651 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1027665947 7:81043043-81043065 GGGACTGGGAGCCGTGGAGCAGG - Intergenic
1027667481 7:81057508-81057530 GGGACTGGGTGCTGTGGAGCTGG + Intergenic
1027674528 7:81142073-81142095 GGGACTGGGCCCCGTGGAGCAGG - Intergenic
1027779002 7:82499905-82499927 GGGACTGGGCGCCTTGGAGCAGG - Intergenic
1027868152 7:83673646-83673668 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1027956090 7:84880862-84880884 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1028058675 7:86282177-86282199 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1028070153 7:86440902-86440924 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1028303249 7:89228793-89228815 GGGACTGGGCGCTATGGAGCAGG + Intronic
1028392728 7:90334748-90334770 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1028511164 7:91627419-91627441 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1028778376 7:94705828-94705850 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1028852465 7:95552491-95552513 GGGACTGGGCGCGGTGGAGCAGG + Intergenic
1029076191 7:97936217-97936239 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1029407154 7:100382067-100382089 GGGACCGGGCGCCGTGGAGCAGG - Intronic
1029441579 7:100589800-100589822 GGGATTGGCCGCAGGAGATCGGG + Intronic
1029494372 7:100889283-100889305 TGGACTGGCCGCCGTACAGGCGG - Exonic
1029832322 7:103274950-103274972 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1029988219 7:104940488-104940510 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1030102083 7:105955835-105955857 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1030215676 7:107042387-107042409 GGGACTGGGCGCCGTGAAGCAGG + Intergenic
1030733537 7:113017678-113017700 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1030780468 7:113593653-113593675 GGGATTGGGCGCCGTGGAGCAGG - Intergenic
1030819263 7:114076876-114076898 AGGACTGGGCGCCGTGGAGCAGG + Intergenic
1031110014 7:117596444-117596466 GGGACTGGGTGCCGTGGAGCAGG - Intronic
1031292207 7:119951536-119951558 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1031409260 7:121422062-121422084 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1031605484 7:123763241-123763263 GGGATTGGACGCCGTGGAGCAGG + Intergenic
1031702728 7:124945145-124945167 GGCACTGGTGGCAGCAGAGCTGG - Intergenic
1032248124 7:130230357-130230379 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1032561554 7:132898632-132898654 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1033312378 7:140271370-140271392 GGAACTGGGCGCCGTGGAGCAGG + Intergenic
1033394040 7:140956980-140957002 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1033866597 7:145697438-145697460 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1034091100 7:148364143-148364165 GGGACTGGGCGCTGTGGAGCAGG - Intronic
1034097968 7:148426743-148426765 GGGACTGGGTGCCGTACAGCAGG - Intergenic
1034155071 7:148949416-148949438 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1034167704 7:149038724-149038746 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1034251859 7:149698912-149698934 GGGACTGTCCCAAGTAAAGCAGG - Intergenic
1034632091 7:152538913-152538935 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1034967043 7:155398170-155398192 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1035151133 7:156874031-156874053 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1035325466 7:158062904-158062926 GGGACTGGGCGCCGCGGAGCAGG - Intronic
1035833959 8:2728132-2728154 GGGACTGGGCGCCGAGGAGCAGG - Intergenic
1036101288 8:5788593-5788615 GAGCGTGGACGCAGTAGAGCAGG + Intergenic
1036306099 8:7603537-7603559 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1036356945 8:8051522-8051544 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1036404636 8:8443484-8443506 GGGACACGCAGCAGTAGGGCAGG + Intergenic
1036440975 8:8781417-8781439 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1036801416 8:11795098-11795120 GGGACTGGGCGCCGTGGAACAGG - Intergenic
1036901625 8:12673740-12673762 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1036915030 8:12796598-12796620 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1037241605 8:16784241-16784263 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1037811031 8:22086890-22086912 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1037957500 8:23070819-23070841 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1037983578 8:23272451-23272473 GGGACTGGGCGCCGTGGAGCGGG - Intronic
1038174119 8:25164830-25164852 GGGATTGGGCGCCGTGGAGCAGG - Intergenic
1039587659 8:38720131-38720153 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1039637357 8:39180462-39180484 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1039922242 8:41901580-41901602 GGGTGTGGCTGCAGTAGAGGAGG - Intergenic
1040003638 8:42600082-42600104 AGGACTGGCCACTGCAGAGCAGG + Intergenic
1040014528 8:42689847-42689869 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
1040026594 8:42787090-42787112 GGGACTGGGCGCCTTGGAGCAGG - Intronic
1040952657 8:52952882-52952904 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1041034608 8:53775926-53775948 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1041545579 8:59038880-59038902 GGGGCAGGCTGCAGGAGAGCAGG - Intronic
1041604305 8:59762023-59762045 GGGACTGGGTGCCGTGGAGCCGG + Intergenic
1041636617 8:60152993-60153015 GGGACTGGACACCGTGGAGCAGG + Intergenic
1041914573 8:63126408-63126430 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1041918981 8:63162324-63162346 GGGACTGGGCGCCGTGGAGTAGG - Intergenic
1042169438 8:65977822-65977844 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1042512518 8:69626510-69626532 GGGACTGGGAGCCATAGAGCAGG + Intronic
1042906167 8:73774224-73774246 GGGACTGGCTTCAGAACAGCTGG - Intronic
1042948707 8:74179557-74179579 GGGACCGGGCGCTGTGGAGCAGG + Intergenic
1043073294 8:75665491-75665513 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1043110152 8:76169905-76169927 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1043129882 8:76447639-76447661 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1043346511 8:79303829-79303851 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1043352436 8:79377229-79377251 GTGACTGGGCGCCGTGGAGCAGG + Intergenic
1043435378 8:80232143-80232165 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1043701175 8:83290685-83290707 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1043709938 8:83403281-83403303 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1043731898 8:83694023-83694045 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1044075875 8:87821169-87821191 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1044088533 8:87971450-87971472 GGGACTGGGCACGGTGGAGCAGG - Intergenic
1044633422 8:94300359-94300381 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1044788737 8:95823973-95823995 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1045096277 8:98800921-98800943 GGGACCGGACGCCGTGGAGCAGG - Intronic
1045232276 8:100316800-100316822 GGGATTGGCTGCCGTGGAGCAGG + Intronic
1045305997 8:100957210-100957232 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1045467710 8:102485539-102485561 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1045743296 8:105387357-105387379 GGGACTGGGCGCCGTAGAGCAGG + Intronic
1046265341 8:111823318-111823340 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1046288959 8:112133026-112133048 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1046445390 8:114311685-114311707 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1046450764 8:114386491-114386513 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1047631654 8:126714663-126714685 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1048186838 8:132249684-132249706 GGGACTGGGCACCGCAGAGCAGG + Intronic
1048655367 8:136530478-136530500 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1048676909 8:136793828-136793850 GGGACTGGGCGCCCTGGAGCAGG + Intergenic
1048757448 8:137755146-137755168 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1049087584 8:140490541-140490563 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1049157741 8:141076975-141076997 GGGACTGGGCGCTGTGGAACAGG - Intergenic
1049193694 8:141303860-141303882 GGGCCTGGGCCCAGTAGAGGTGG + Intronic
1049487644 8:142874865-142874887 GGGACTGGCCTCGGCAGAGTGGG - Intronic
1049500367 8:142959811-142959833 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1049857974 8:144875462-144875484 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1050249995 9:3734101-3734123 GGGACTGGGCGCCGTGGAGTAGG - Intergenic
1050472566 9:6008097-6008119 GGGCCTGGCCGGTGAAGAGCAGG - Intergenic
1051305037 9:15700070-15700092 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1051314127 9:15810424-15810446 GGGACCGGGCGCTGTGGAGCAGG + Intronic
1051383358 9:16480842-16480864 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1051439908 9:17072937-17072959 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1051459293 9:17294701-17294723 GGGACTGGCTGCCGTGGAGCAGG + Intronic
1051463850 9:17354269-17354291 GGGACTGGGCGCCCTGGAGCAGG - Intronic
1051892747 9:21959585-21959607 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1051928999 9:22363493-22363515 GGGACTAGGCGCCGTGGAGCAGG + Intergenic
1052056629 9:23914485-23914507 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
1052075496 9:24135401-24135423 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1052313471 9:27092945-27092967 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1052979602 9:34438279-34438301 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1053027232 9:34740262-34740284 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1053313498 9:37034435-37034457 CGGCCCGGCCGGAGTAGAGCGGG + Intergenic
1053436137 9:38075658-38075680 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1053475285 9:38377865-38377887 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1053483334 9:38432788-38432810 AGGCTTGGCCACAGTAGAGCAGG + Intergenic
1053547861 9:39042383-39042405 GGGACCGGGCGCCGTGGAGCAGG + Intergenic
1053811986 9:41862424-41862446 GGGACTGGGCTCCGTGGAGCAGG + Intergenic
1054618609 9:67325015-67325037 GGGACTGGGCTCCGTGGAGCAGG - Intergenic
1054722507 9:68617358-68617380 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1055049412 9:71963872-71963894 GGGACTGGGCTCCGTGGAGCAGG - Intronic
1055102521 9:72480265-72480287 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1055461411 9:76523755-76523777 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1055651422 9:78410329-78410351 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1055925677 9:81507703-81507725 GGGACTGGGGGCCGTAGAGCAGG - Intergenic
1056068393 9:82960744-82960766 GGGACTGGCCTCAGATGAGGTGG + Intergenic
1056216332 9:84408815-84408837 GGGACTGGACGCCATGGAGCAGG - Intergenic
1056735982 9:89209693-89209715 GGGACTGGGCACTGTGGAGCAGG - Intergenic
1056743803 9:89282759-89282781 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1056771342 9:89480444-89480466 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1056799582 9:89681586-89681608 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1057118217 9:92545580-92545602 GGGACTGGACGCGGTGGAGCAGG - Intronic
1057300754 9:93880243-93880265 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1057383871 9:94591170-94591192 GGGACTGAGCGCTGTGGAGCGGG + Intronic
1057511184 9:95680665-95680687 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1057543809 9:96001745-96001767 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1057628581 9:96700914-96700936 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
1057726958 9:97574508-97574530 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1058174818 9:101724141-101724163 GGGACTGGGCGCCATGGAGCAGG + Intronic
1058235646 9:102487009-102487031 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1058365231 9:104200928-104200950 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1058585332 9:106501365-106501387 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1058786548 9:108393848-108393870 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1058799417 9:108530477-108530499 GGGACTGGGCGCCGTGGAGTAGG - Intergenic
1059713327 9:116889461-116889483 GGGATTGGCCTCATTAGAGATGG - Intronic
1059810673 9:117852359-117852381 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1059891405 9:118809285-118809307 GGGACTGGGCTCCGTGGAGCAGG + Intergenic
1060091392 9:120746679-120746701 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1060305329 9:122406225-122406247 GGGACTGGGCGCCGTAGAGCAGG + Intergenic
1060815372 9:126632438-126632460 GGGACTGGAGGCTGCAGAGCAGG + Intronic
1061483881 9:130910456-130910478 GGGACCGGGCGCTGTGGAGCAGG - Intronic
1061696611 9:132380523-132380545 GGCACAGGCTGCCGTAGAGCTGG - Intronic
1062051014 9:134447115-134447137 AGGACGGGCAGCAGGAGAGCAGG - Intergenic
1062146161 9:134991059-134991081 GGGACCGGGCACAGTGGAGCAGG + Intergenic
1062419266 9:136471716-136471738 GGGTCTGGCCCCAGTAGGGGTGG + Intronic
1203429845 Un_GL000195v1:80654-80676 GGGACTGGGTGCTGTGGAGCAGG - Intergenic
1203662422 Un_KI270753v1:57665-57687 GGGACTGGGAGCTGTGGAGCAGG - Intergenic
1186152546 X:6690534-6690556 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1186257153 X:7734503-7734525 GGGGATGGCCACAGTAGAACTGG + Intergenic
1186282045 X:8003343-8003365 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1186293258 X:8121943-8121965 GGGACTGGGCGTTGTGGAGCAGG - Intergenic
1186323203 X:8452517-8452539 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1187005796 X:15231757-15231779 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1187139103 X:16575786-16575808 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1187304659 X:18084137-18084159 GGGACTGAGCGCCGTGGAGCAGG - Intergenic
1187557524 X:20366876-20366898 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1187904064 X:24050026-24050048 GGGACTGGGCGCTGTGGAGCAGG - Intergenic
1188112051 X:26205093-26205115 GGGACTGCCTGCCGTGGAGCAGG - Intergenic
1188166912 X:26873727-26873749 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1188189578 X:27157337-27157359 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1188242724 X:27809625-27809647 GGGACTGGGCACCGCAGAGCGGG - Intronic
1189209879 X:39275914-39275936 GGGACTGGGTGCAGTGGAGCAGG - Intergenic
1189896797 X:45664844-45664866 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1190045819 X:47111030-47111052 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1190413917 X:50163357-50163379 GGGACTGGGCGCAGTGGAGCAGG + Intergenic
1190918430 X:54827081-54827103 GGGAGAGGCCGCAGTAGAAGAGG + Intergenic
1191053864 X:56222630-56222652 GGGACTGGGCACGGTGGAGCAGG + Intergenic
1192251460 X:69417102-69417124 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1193040158 X:76996685-76996707 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
1193538109 X:82738230-82738252 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1193708923 X:84856671-84856693 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
1193803989 X:85972385-85972407 GGGACTGGGCGCCGTGGAGCAGG + Intronic
1194025550 X:88746398-88746420 GGGACTGTGCGCTGTGGAGCAGG + Intergenic
1194071552 X:89331056-89331078 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1194166395 X:90521669-90521691 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1194340397 X:92699512-92699534 GGGACTGGGTGCTGCAGAGCAGG + Intergenic
1194650773 X:96512278-96512300 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1194890440 X:99372098-99372120 GGGACCGGGCGCAGTGGAGCAGG + Intergenic
1195687604 X:107600743-107600765 GGGCCTGGCCACACTAGGGCAGG + Exonic
1196197881 X:112854925-112854947 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1196319485 X:114270587-114270609 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1196582740 X:117395014-117395036 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1196662481 X:118282768-118282790 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1196705861 X:118716963-118716985 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1196714663 X:118799290-118799312 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1196728882 X:118922010-118922032 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1196761927 X:119208499-119208521 GGGACTGGGCGCTGCGGAGCAGG + Intergenic
1196762298 X:119210906-119210928 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1196775251 X:119332208-119332230 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1196775560 X:119333929-119333951 GGGACTGGCCGCAGTAGAGCAGG - Intergenic
1196781418 X:119387611-119387633 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1196793936 X:119487890-119487912 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1196827220 X:119750848-119750870 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1196860813 X:120025795-120025817 GGGACTGGGTGCTGTGGAGCAGG + Intergenic
1197000239 X:121431555-121431577 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1197331127 X:125155495-125155517 GGGACTGGGCTCCGTGGAGCAGG + Intergenic
1197344783 X:125319089-125319111 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1197978804 X:132194419-132194441 GGGACTGGGCGCCGCAGAGCAGG - Intergenic
1198300036 X:135325788-135325810 GGGACTGGGCGCCGTGGAGCAGG - Intronic
1198664265 X:139004052-139004074 GGGACTGGGCGCTGTGGAGCAGG + Intronic
1198694500 X:139321137-139321159 GGGACTGGGCGCCGTCGAGCAGG - Intergenic
1198972541 X:142298272-142298294 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1199009891 X:142745750-142745772 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1199050184 X:143228718-143228740 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1199175589 X:144783952-144783974 GGGACTGGGCGCCCTGGAGCAGG - Intergenic
1199285051 X:146046212-146046234 GGGACTGGGCGCCATGGAGCAGG + Intergenic
1199356197 X:146866909-146866931 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1199570534 X:149263007-149263029 GGGTATGGCTGGAGTAGAGCTGG - Intergenic
1199628151 X:149758859-149758881 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1199787458 X:151117760-151117782 AGGACTGGCCTCCATAGAGCAGG - Intergenic
1199831233 X:151551213-151551235 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1199831750 X:151555218-151555240 GGGACTGGGCACCGTGGAGCAGG + Intergenic
1199941944 X:152636379-152636401 AGGACTGGTAGCAGTAGAGGTGG + Intergenic
1200423514 Y:2998402-2998424 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1200512663 Y:4099450-4099472 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1200648766 Y:5816264-5816286 GGGACTGGGTGCTGCAGAGCAGG + Intergenic
1200725790 Y:6666785-6666807 GGGACTGGGCGCCGAGGAGCAGG + Intergenic
1200824245 Y:7622243-7622265 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1201422999 Y:13820232-13820254 GGGACTGGGCGCTGTGGAGCAGG + Intergenic
1201468377 Y:14309577-14309599 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1201469144 Y:14314784-14314806 GGGACTGGGCGCCATGGAGCAGG - Intergenic
1201488205 Y:14513147-14513169 GGGACTGGGCGCCGTGGAGCAGG - Intergenic
1201496888 Y:14598224-14598246 GGGACTGGGTGCCGTGGAGCAGG + Intronic
1201573075 Y:15434177-15434199 GGGACTGGGCACCGTGGAGCAGG - Intergenic
1201901064 Y:19046598-19046620 GGGACTGGGCGCCTTGGAGCAGG + Intergenic
1201982573 Y:19923743-19923765 GGGACTGGGCGCCGTGGAGCAGG + Intergenic
1202235809 Y:22708844-22708866 GGGACTGGGTGCCGTGGAGCAGG - Intergenic
1202307354 Y:23487324-23487346 GGGACTGGGTGCCGTGGAGCAGG + Intergenic
1202563451 Y:26183262-26183284 GGGACTGGGTGCCGTGGAGCAGG - Intergenic