ID: 1196776876

View in Genome Browser
Species Human (GRCh38)
Location X:119346250-119346272
Sequence CTGTGCTAACTGCTGCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196776873_1196776876 17 Left 1196776873 X:119346210-119346232 CCAAAGGAAGAAGGGGTTTTGAT No data
Right 1196776876 X:119346250-119346272 CTGTGCTAACTGCTGCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196776876 Original CRISPR CTGTGCTAACTGCTGCTGTA AGG Intergenic
No off target data available for this crispr