ID: 1196785340

View in Genome Browser
Species Human (GRCh38)
Location X:119417084-119417106
Sequence ACCAGGGCCTTGAGCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196785331_1196785340 5 Left 1196785331 X:119417056-119417078 CCTCCCCATAGTGGGCCAGTCCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1196785340 X:119417084-119417106 ACCAGGGCCTTGAGCCTCAAGGG 0: 1
1: 1
2: 1
3: 11
4: 238
1196785332_1196785340 2 Left 1196785332 X:119417059-119417081 CCCCATAGTGGGCCAGTCCAAAA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1196785340 X:119417084-119417106 ACCAGGGCCTTGAGCCTCAAGGG 0: 1
1: 1
2: 1
3: 11
4: 238
1196785337_1196785340 -10 Left 1196785337 X:119417071-119417093 CCAGTCCAAAACAACCAGGGCCT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1196785340 X:119417084-119417106 ACCAGGGCCTTGAGCCTCAAGGG 0: 1
1: 1
2: 1
3: 11
4: 238
1196785333_1196785340 1 Left 1196785333 X:119417060-119417082 CCCATAGTGGGCCAGTCCAAAAC 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1196785340 X:119417084-119417106 ACCAGGGCCTTGAGCCTCAAGGG 0: 1
1: 1
2: 1
3: 11
4: 238
1196785328_1196785340 17 Left 1196785328 X:119417044-119417066 CCAGCTTAGCTTCCTCCCCATAG 0: 1
1: 0
2: 0
3: 10
4: 181
Right 1196785340 X:119417084-119417106 ACCAGGGCCTTGAGCCTCAAGGG 0: 1
1: 1
2: 1
3: 11
4: 238
1196785334_1196785340 0 Left 1196785334 X:119417061-119417083 CCATAGTGGGCCAGTCCAAAACA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1196785340 X:119417084-119417106 ACCAGGGCCTTGAGCCTCAAGGG 0: 1
1: 1
2: 1
3: 11
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196785340 Original CRISPR ACCAGGGCCTTGAGCCTCAA GGG Intronic
902050353 1:13559450-13559472 ACCAGGGACTTGAGGATCCAAGG + Intergenic
902621264 1:17652303-17652325 ACCAAGGCCTTCTGACTCAAGGG + Intronic
903308608 1:22433590-22433612 ATCAGGGACTTGAGCATCCATGG + Intergenic
904790416 1:33016136-33016158 ATCAGGGACTTGAGCATCTATGG - Intronic
905941606 1:41867638-41867660 AGCAGGGCCTTGTGCTTCCAAGG - Intronic
907221378 1:52909342-52909364 ACAAGGGGCTTGAGCATCCATGG - Intronic
908160082 1:61398292-61398314 GTCAGGGCCTTGAGCAACAAAGG + Intronic
909660962 1:78081521-78081543 ACCAGGGACTTGAACATCAGTGG + Intronic
911139734 1:94486255-94486277 ATCAGGGACTTGAGCATCCATGG + Intronic
916745154 1:167679594-167679616 GCCAGAGCCCAGAGCCTCAAAGG - Intronic
918305176 1:183239652-183239674 AACAGGGCTCTGAGCCTCAGAGG - Intronic
920861687 1:209713617-209713639 ACAAGGGACTTGAGCATCCATGG - Intronic
922908881 1:229198894-229198916 AACAGGGACTTGAGCATCCATGG + Intergenic
922998231 1:229983970-229983992 ATCAGGGACTTGAGCTTCCATGG + Intergenic
923162596 1:231329487-231329509 ACCAGGGACTTGAGCGTCTGTGG + Intergenic
1070673116 10:78392163-78392185 ACCAGGGACTTGAGCATCCCTGG + Intergenic
1071008673 10:80912514-80912536 ACCAGCTCCTTAAGCCTCACTGG - Intergenic
1071236659 10:83657482-83657504 ACCAGAGCCTAGGGCCTCAGGGG + Intergenic
1071921098 10:90351635-90351657 ACCAGGGACTTGAACATCAGTGG + Intergenic
1075059567 10:119246173-119246195 ATCAGGGACTTGAGCATCCATGG - Intronic
1075063098 10:119270517-119270539 ATCAGGGACTTGAGCATCCATGG + Intronic
1075797290 10:125129757-125129779 TCCAGGGCCTTGGTCCTCACAGG - Intronic
1076087907 10:127651465-127651487 TCCAGGTCCTAAAGCCTCAATGG - Intergenic
1077062846 11:625364-625386 ACCCGGGTTCTGAGCCTCAAGGG - Intronic
1077939374 11:6824363-6824385 AGCAGGGACTTGAGCTTCAAAGG + Intergenic
1081681799 11:45011447-45011469 AGCAGAGCCTTGAGGCTCAGTGG + Intergenic
1084088428 11:66865364-66865386 TCCAGGGGCCTGAGCCCCAAAGG - Intronic
1084319898 11:68367414-68367436 ACCAGGGCCTTGCTCCACCAGGG - Intronic
1084754059 11:71223591-71223613 ATCAGGGACTTGAGCATCCATGG + Intronic
1085714013 11:78855864-78855886 TCCAGAGCCTTAAGCCTGAAGGG - Intronic
1088174221 11:107032750-107032772 ATAAGGGACTTGAGCCTCCATGG - Intergenic
1090610268 11:128465026-128465048 ACCCAGGCCTTTAGACTCAAAGG + Intronic
1091327904 11:134705631-134705653 ACTTAGGCCTTGAGCCTGAAAGG - Intergenic
1091796885 12:3302512-3302534 ATCAGGGACTTGAGCATCAGTGG - Intergenic
1092893339 12:12989969-12989991 ATCAGGGACTTGAGCATCCATGG - Intronic
1093908221 12:24716539-24716561 ACCTGGCCCTAGAGCCACAAAGG + Intergenic
1094711660 12:32969852-32969874 ATCAGGGCCTCGAGCATCCATGG - Intergenic
1100342772 12:93696928-93696950 ATCAGGGACTTGAGCATCCATGG + Intronic
1101366877 12:104080289-104080311 ATCAGGGACTTGAGCATCCATGG - Intronic
1102914844 12:116745000-116745022 ACCATGGCTATGATCCTCAAGGG - Intronic
1104806304 12:131591741-131591763 ACCAGGGCCATGCGGCTCCACGG + Intergenic
1104971942 12:132534738-132534760 GCCTGGGCCTTGAGCCACCAAGG - Intronic
1106232817 13:27834441-27834463 AGCAGGGACTTGAGCATCCATGG - Intergenic
1106922036 13:34574215-34574237 ACCAGGGGCTTGATCATCCATGG + Intergenic
1106923598 13:34590146-34590168 ACGAGTGCCTTGGTCCTCAAGGG - Intergenic
1107147954 13:37079820-37079842 ACAAGGGACTTGAGCATCCATGG + Intergenic
1107710870 13:43149347-43149369 ATCAGGGACTTGAGCATCCATGG - Intergenic
1108463885 13:50695171-50695193 CCCAGTGCCTTGAGCCTGAATGG + Intronic
1108951834 13:56104158-56104180 ATCAGGGACTTGAGCATCCATGG - Intergenic
1109242022 13:59901261-59901283 ACCAGGGCCTTGATCATGCATGG - Intronic
1113675985 13:112208329-112208351 ACAAGGGCCTTGGGCATCCATGG - Intergenic
1115472464 14:33782606-33782628 TCCAGAGCCTTGAGCCTCCCTGG - Intronic
1121486681 14:94321717-94321739 ACCTGGGACCTGAGTCTCAAAGG - Intronic
1121696898 14:95920986-95921008 TCCTGGGCCTTGAGCCTGCAGGG - Intergenic
1122347877 14:101071636-101071658 ACCAGGGCCTTTGGCCTCTCGGG - Intergenic
1122651451 14:103229194-103229216 ATCAGGGCTCTGAGCCTCAGTGG + Intergenic
1124155288 15:27219716-27219738 ACCAGGGACTGGAGCATCAGTGG + Intronic
1124579001 15:30935603-30935625 ATCAGGGACTTGAGCATCCATGG + Intronic
1125516740 15:40324748-40324770 ACCAGGGCCCTGAGCCGTAGGGG + Intergenic
1127318848 15:57823023-57823045 ATCAGGGACTTGAGCATCCATGG + Intergenic
1127379294 15:58416341-58416363 ATCAGGGACTTGAGCATCAGTGG + Intronic
1131317293 15:91350987-91351009 ATCAGGGACTTGAGCATCCATGG - Intergenic
1132981194 16:2739455-2739477 ACCTGGGACCTGAGCCTCCAGGG + Intergenic
1133307943 16:4822844-4822866 CCAAGGGCCAAGAGCCTCAAAGG + Intronic
1133465902 16:6026746-6026768 CCCAGGGCCTTGAGACTCCAAGG - Intronic
1133879432 16:9766492-9766514 GCCAGTGCCCTGAGCCTCAGGGG - Intronic
1134999126 16:18761716-18761738 ATCAGGGACTTGAGCTTCTATGG + Intergenic
1137405715 16:48187642-48187664 ACGAGGACCTTGAGACTCAGAGG - Intronic
1138908478 16:61367433-61367455 ACTAGGACTTTGAGTCTCAAAGG - Intergenic
1139925523 16:70483685-70483707 AACAGGGCCTTTAGTCTCAAGGG + Intronic
1141207527 16:81944792-81944814 ATCAGGGACTTGAGCCTCCAAGG + Intronic
1142206672 16:88786051-88786073 GCCAGTGCCTTGAGGCTCAGTGG - Intergenic
1142357357 16:89608070-89608092 ATCAGGGACTTGAGCATCCATGG - Intergenic
1142992808 17:3743039-3743061 GCCAGGGCCTTCAGGCTGAATGG - Intronic
1145104025 17:20099924-20099946 ATCAGGGACTTGAGCATCCATGG - Intronic
1146650546 17:34603608-34603630 ACCTGGGTCTGGAGCCTCAGAGG + Intronic
1147434528 17:40400994-40401016 ACCAGCGTGTTGAGCCTGAATGG - Exonic
1148286733 17:46400127-46400149 ACCAGTGCCTTCAGCCCCACTGG + Intergenic
1148308899 17:46617717-46617739 ACCAGTGCCTTCAGCCCCACTGG + Intronic
1150117956 17:62571223-62571245 ATCAGGGACTTGAGCATCCATGG - Intronic
1150674057 17:67229080-67229102 ACCAGGGCCTTGCTGCTCAGTGG - Intronic
1151179984 17:72320347-72320369 TCCAGGGCATTGCGGCTCAACGG + Intergenic
1151457110 17:74232754-74232776 ACCAGGGCCATGACCTTCACGGG + Intronic
1151781426 17:76248780-76248802 ATCAGGGACTTGAGCATCCAAGG - Intergenic
1153932644 18:9892183-9892205 ACCAGAGCCTTAAGAATCAATGG + Intergenic
1154115715 18:11611577-11611599 ATCAGGGACTTGAGCATCCATGG + Intergenic
1154120159 18:11645796-11645818 ATCAGGGACTTGAGCATCCATGG + Intergenic
1156303318 18:35854257-35854279 ACCTGGCCCTTGAGGCTAAATGG + Intergenic
1156347044 18:36266685-36266707 ACCAGAGCCTTGCACCTCAGAGG - Intronic
1156479608 18:37427678-37427700 CCCAGGGCCTTGAGCAGGAAGGG - Intronic
1157061200 18:44292740-44292762 ACATGGGCCTTGAGCAACAAAGG + Intergenic
1157479812 18:48046381-48046403 AGCAGGGTCCTGACCCTCAAAGG + Intronic
1158267708 18:55678406-55678428 ACCAGGGCCTTAAGCCACTGAGG - Intergenic
1158383960 18:56967761-56967783 ATCAGGGACTTGAGCATCTATGG - Intronic
1159089013 18:63825280-63825302 ACCAGCTCCTGGAGTCTCAAAGG + Intergenic
1159596389 18:70386296-70386318 ACCAGGGACTTGAGCATCTGCGG - Intergenic
1160426945 18:78784178-78784200 ACCAGGGACATGTGCCTCCAGGG - Intergenic
1160570882 18:79816872-79816894 ACCAGTGCCTTGAGGCTGTATGG + Intergenic
1161058081 19:2200562-2200584 ACAAGCGCCTTGGGCCTCCAGGG - Intronic
1161142032 19:2653777-2653799 ACACGGGCCCTGGGCCTCAAGGG - Intronic
1162403351 19:10459347-10459369 TCCAGGGCCCTGAGCCTTACAGG + Intronic
1163249574 19:16118484-16118506 ACCAGGGCCTACAGCATCATAGG + Intronic
1164763301 19:30744065-30744087 AGCAGGGCCTTGTTCCTAAATGG - Intergenic
1164994136 19:32707275-32707297 AACAGAGCCCTGGGCCTCAAAGG - Intronic
1166108043 19:40607167-40607189 AGAAGGGCTTGGAGCCTCAATGG - Intronic
1166690518 19:44819406-44819428 ACCAGCGCCCTGAGCCGCGATGG + Exonic
925836199 2:7949551-7949573 ATCAGGACTTTGATCCTCAAAGG + Intergenic
926141510 2:10371102-10371124 ACCAGGGCCTGGAGCAGCAGGGG + Intronic
926655724 2:15403614-15403636 ATCAGGGACTTGAGCATCCATGG + Intronic
927522824 2:23710846-23710868 ATCAGGGACTTGAGCATCCAGGG + Intergenic
928333323 2:30374519-30374541 ACCAGAGCACTGAGCCTCTATGG + Intergenic
930004595 2:46886286-46886308 ATCAGGGACTTGAGCATCCATGG + Intergenic
931642465 2:64393906-64393928 ACCACAGCACTGAGCCTCAAAGG - Intergenic
932465399 2:71920372-71920394 ATCAGGGACTTGAGCATCCATGG + Intergenic
932668662 2:73718402-73718424 ACAAGAGCCTTGAGCGTCCATGG + Intergenic
934935694 2:98463763-98463785 ACCAGAGCCATGAGCGTCCATGG + Intronic
935262439 2:101366982-101367004 ATCAGGGACTTGAGCATCCACGG + Intronic
935819382 2:106878743-106878765 ATCAGGGACTTGAGCATCCATGG + Intronic
936404770 2:112193121-112193143 ATCAGGGACTTGAGCATCCATGG - Intergenic
939526935 2:143306993-143307015 ACGAGGACCCTGAGCCTCAGAGG - Intronic
940782729 2:157950318-157950340 ATCAGGGACTTGAGCTTCCATGG + Intronic
941391394 2:164919602-164919624 ATCAGGGACTTGAGCATCCATGG - Intronic
942402608 2:175619403-175619425 CCTAGGCCCATGAGCCTCAAAGG + Intergenic
945637876 2:212380400-212380422 ACCAGGGACTTGAGTATCCATGG + Intronic
946439278 2:219681384-219681406 ACCAGGGCCTTGAGCAAGCAGGG + Intergenic
946741419 2:222806080-222806102 ACCAGGGCTATGTTCCTCAAAGG - Intergenic
947453174 2:230227035-230227057 ATCAGGGACTTGAGCATCCATGG + Intronic
948318597 2:237050697-237050719 AGCAGGGCGGTGAGCCTGAAAGG - Intergenic
1169008934 20:2233681-2233703 ACAAGGGACTTGAGCATCCATGG + Intergenic
1171198790 20:23224576-23224598 ACAAGGGACTTGAGCATCCATGG - Intergenic
1174166197 20:48585263-48585285 AGCAGAGCCTGGGGCCTCAAGGG + Intergenic
1176665646 21:9685140-9685162 ATCAGGGACTTGAGCGTCTAGGG + Intergenic
1178975772 21:37220113-37220135 ACCGGGCCCTTCAGCCTCATGGG + Intergenic
1181021281 22:20104628-20104650 ATCAGGCCCTGGAACCTCAAGGG - Intronic
1181048989 22:20229902-20229924 ACGGGGGACTTGAGACTCAAGGG - Intergenic
1181258306 22:21578886-21578908 ATCAGGGCACTGAGGCTCAAAGG - Intronic
1181881009 22:25979943-25979965 GCCAGGGACTGGAGCTTCAATGG - Intronic
1182359459 22:29738162-29738184 GCCAGGGCCTGGGGCCCCAAGGG + Intronic
1184524732 22:45015127-45015149 ATCAGGGACTTGAGCATCCATGG - Intergenic
1184815132 22:46863173-46863195 CCCAGGGCCTTGAGTCTGATGGG + Intronic
1185203638 22:49523793-49523815 TCCAGGATCTTGAGCCTCCAGGG - Intronic
1185269158 22:49920670-49920692 CACATGGCCTTGAGCCCCAATGG + Intronic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
953340727 3:42132126-42132148 ATCAGGGACTTGAGCATCCATGG - Intronic
953878394 3:46679214-46679236 ACCAGGGACCTGACCCTCATGGG - Exonic
954477719 3:50764484-50764506 ATCAGGGACTTGAGCATCCATGG + Intronic
954526414 3:51275687-51275709 ACCAGAGCTCTGAGCCTCAGAGG + Intronic
954656771 3:52198609-52198631 GCCAGCGCCTTGGGCCTCACTGG - Intronic
956947253 3:74236575-74236597 ATCAGGGACTGGAGCATCAATGG + Intergenic
958123575 3:89326201-89326223 ACAAGGGACTTGAGCATCCATGG - Intronic
959067800 3:101676275-101676297 GCCGGGGCCTACAGCCTCAAGGG + Intronic
959152825 3:102628512-102628534 ACCAGGGACTTGAGCATCCTTGG + Intergenic
959694456 3:109234414-109234436 ACCAGGGCCTTGAGTCTCAATGG + Intergenic
961501813 3:127341526-127341548 ATCAGGGACTTGAGCATCCACGG - Intergenic
964006868 3:151840710-151840732 AACAGGAACTTGAGCATCAATGG - Intergenic
965361134 3:167739622-167739644 TCCAGGGCCTTGAGGTTAAATGG - Intronic
965820647 3:172681084-172681106 CTCAGGGCCCTGAGCCTCTATGG - Intronic
966898406 3:184462958-184462980 ATCAGGGACTTGAGCATCCATGG + Intronic
968454473 4:689916-689938 AACAGGGCCTGGAGCCTCTTGGG - Intergenic
969234733 4:5857907-5857929 AACAGGGCAGTAAGCCTCAAGGG - Intronic
969249910 4:5960481-5960503 AGCAGGGCCTTTTGCCTCACTGG + Intronic
969964953 4:10984572-10984594 CCCAGGTCCTGGAGCCTCTATGG + Intergenic
970965238 4:21920696-21920718 ATCAGGGACTTGAGCATCCATGG + Intronic
973550830 4:52034562-52034584 ATAAGGGACTTGAGCATCAATGG + Intronic
974295235 4:59989436-59989458 ACCAGGGCCTTGAATAACAATGG - Intergenic
974499725 4:62684329-62684351 TCCAGGGGCCTGAGCCTCTAAGG + Intergenic
975631638 4:76410044-76410066 ACCAGGGCCTTTCGACTCCAAGG - Intronic
985296402 4:188441847-188441869 ATCAGGGTCTTGAGCATCCACGG + Intergenic
985411368 4:189689404-189689426 ATCAGGGACTTGAGCGTCTAGGG + Intergenic
986581395 5:9270151-9270173 CCCAGGGCATTGAGCCTCTCTGG + Intronic
988451737 5:31350756-31350778 ACCAGGGCAGTGATGCTCAAAGG - Intergenic
988791000 5:34607531-34607553 ATCAGGGACTTGAGCATCCATGG + Intergenic
990402107 5:55448832-55448854 ATCAGGGACTTGAGCATCCATGG - Intronic
990845562 5:60134598-60134620 ATCAGGGGCTTGAGCATCCATGG - Intronic
991603879 5:68380809-68380831 ATCAGGGACTTGAGCATCACTGG - Intergenic
995708374 5:115009342-115009364 ATCAGGGACTTGAGCATCCATGG - Intergenic
996280045 5:121719391-121719413 AAAAGGGCTTTGAGCCTCTAGGG + Intergenic
996897929 5:128507336-128507358 ATCAGGGACTTGAGCCTCTATGG - Intronic
996949359 5:129107677-129107699 ATCAGGGACTTGAGCATCCATGG + Intronic
999211916 5:149896909-149896931 CCCAGGACCTTGTGCATCAATGG - Intronic
999371470 5:151057903-151057925 ATCAGGGACTTGAGCATCCATGG + Intronic
1000635984 5:163644190-163644212 ATAAGGGCCTTGAGCATCCATGG - Intergenic
1002589455 5:180279424-180279446 CCCAGGGCCTTCAGCCGCCAGGG + Intronic
1002883340 6:1272281-1272303 ATCAGGGACTTGAGCATCCATGG + Intergenic
1006139710 6:31920919-31920941 TCCAGGGCCCTGGGCCTCAGAGG - Intronic
1006640085 6:35485381-35485403 TCCAGGGACTTGGGCCTGAAAGG + Intronic
1006678348 6:35779476-35779498 ACCAGGGCCTATGGCCCCAAGGG - Exonic
1007763895 6:44150041-44150063 CCCAGGGCCAGGAGCCTGAAGGG - Intronic
1007955986 6:45918345-45918367 ACCAGGGCATGGAGGCTGAATGG + Intronic
1008890071 6:56477752-56477774 ATCAGGGACTTGAGCATCATTGG - Intronic
1009525356 6:64737958-64737980 ACCATGGCTTTGAGCATCGATGG - Intronic
1009992908 6:70865549-70865571 ATCAGGGACTTGAGCGTCCATGG + Intronic
1010020166 6:71150211-71150233 AACAGGGCTTTGAGCGTCATGGG - Intergenic
1010521037 6:76837765-76837787 ACCAGCGCCTTGAGCCTCCAAGG - Intergenic
1011097170 6:83679214-83679236 ATCAGGGACTTGAGCTTCCACGG + Intronic
1011669019 6:89664298-89664320 ACCAGGGACTTCTGCCTCAGTGG + Intronic
1012086780 6:94836730-94836752 ACCAGGGACTTGAGCATTCATGG - Intergenic
1012403397 6:98864654-98864676 ACCAGGGCCTAGAGTATGAATGG - Intergenic
1013137710 6:107298493-107298515 ATCAGGGACTTGAGCATCCAAGG + Intronic
1013469100 6:110445332-110445354 ACCAGGGTCTGGAGGGTCAAGGG - Intronic
1014459529 6:121679526-121679548 ATCAGGGACTTGAGCATCCATGG + Intergenic
1014473498 6:121844681-121844703 ACCACAGCCTTGAACCTCCAGGG - Intergenic
1015372735 6:132473343-132473365 ATCAGGGACTTGAGCATCAGCGG - Intronic
1016848356 6:148591636-148591658 ATCAGGGACTTGAGCATCCAGGG + Intergenic
1017803179 6:157917620-157917642 ATCAGGGACTTGAGCATCAATGG - Intronic
1019943100 7:4306588-4306610 ACCAGAGCTTAGAGCCTCCAGGG - Intergenic
1020393291 7:7684007-7684029 ATCAGAGCGTTGAGCGTCAATGG - Intronic
1022106771 7:27202348-27202370 GCCAGGGCTTTGAGCCTCTTCGG + Intergenic
1022122473 7:27322953-27322975 ATCAGGGACTTGAGCATCCATGG + Intergenic
1024567303 7:50692218-50692240 ATCAGGGCCTTGAGCATCCTTGG + Intronic
1024933987 7:54693226-54693248 ACCAGGGACTTGAGCATCTGTGG + Intergenic
1030316073 7:108115792-108115814 ATCAGGGACTTGAGCATCCATGG + Intronic
1031741926 7:125443404-125443426 ATCAGGGACTTGAGCATCCATGG - Intergenic
1032900329 7:136300139-136300161 ATCAGGGACTTGAGCATCTATGG + Intergenic
1033884568 7:145929220-145929242 AGCAGGCTCTTGAGCCTCCAAGG - Intergenic
1035014677 7:155754608-155754630 ACCAAAGCCTTGAGCCTCTGAGG - Intronic
1036077925 8:5521934-5521956 ACCAGTGGCTTGAGCTGCAAAGG - Intergenic
1036181640 8:6590849-6590871 ACCAGGGCCTTGAGGTCCAAAGG - Intronic
1038392118 8:27211662-27211684 ACCAGGGACTTGAGCATCCTTGG + Intergenic
1039393414 8:37201736-37201758 ATCAGGGACTTGAGCTTCCATGG + Intergenic
1039881932 8:41630547-41630569 CCCAGGCCCTTGAGACTCAGGGG + Intergenic
1041103560 8:54420050-54420072 ATCAGGGACTTGAGCATCCATGG + Intergenic
1042832891 8:73051153-73051175 CCCAGTTCCTTGAGCCTTAAGGG + Intergenic
1044246253 8:89950257-89950279 ATCAGGGACTTGAGCATCCATGG - Intronic
1046592543 8:116223767-116223789 ACCATGGCCTAGTGCCTGAAAGG - Intergenic
1048591940 8:135828350-135828372 ACCAGTGCCATGAGCCTGGAGGG - Intergenic
1049423544 8:142527199-142527221 CCCAGGGCCCTGTCCCTCAAAGG - Intronic
1049806851 8:144545001-144545023 ACGAGGGCTTGGGGCCTCAATGG - Intronic
1051089886 9:13393945-13393967 TCTAGGGCCTAGAGCTTCAAAGG + Intergenic
1051675503 9:19554443-19554465 ATCAGGGACTTGAGCATCCATGG + Intronic
1052662610 9:31454812-31454834 ATCAGGGACTTGAGCATCAGTGG - Intergenic
1054743074 9:68828104-68828126 ACCAGGGCCTTGACTGTCATGGG + Intronic
1055169292 9:73235627-73235649 ATCAGGGACTTGAGCATCCATGG + Intergenic
1055554548 9:77461375-77461397 AACATGGGCTTGGGCCTCAACGG + Intronic
1056606053 9:88086044-88086066 ACCATGGCCTTGAGACCCAAAGG - Intergenic
1060212398 9:121718518-121718540 ACCAGGGCCTGGTGGCTCAGGGG - Intronic
1061155930 9:128861648-128861670 ACCTGTGCCTTGAGCAACAAAGG + Intronic
1062017400 9:134297716-134297738 TCCAGGGCCTTCAGCCTCCCAGG + Intergenic
1062339878 9:136089260-136089282 GCCAGGGCCCAGGGCCTCAAAGG + Intronic
1203660457 Un_KI270753v1:36621-36643 ATCAGGGACTTGAGCGTCTAGGG - Intergenic
1203671228 Un_KI270755v1:13578-13600 ATCAGGGACTTGAGCGTCTAGGG - Intergenic
1186591839 X:10938858-10938880 AGCAGAGAGTTGAGCCTCAAGGG - Intergenic
1187055489 X:15738218-15738240 ACCAGGGCCACGCCCCTCAATGG - Intronic
1189589929 X:42500085-42500107 ACCAGGGACTTGGGCATCATTGG + Intergenic
1190753321 X:53380633-53380655 ACCAAGGCCGAGAGCCTCATTGG - Exonic
1191920317 X:66249132-66249154 ACCAAGCCCTTGAGCCTCAGAGG - Intronic
1194285600 X:92007118-92007140 ACCAGGGCCTTGAGCAAACATGG - Intronic
1196710864 X:118760806-118760828 ATCAGGGACTTGAGCATCCATGG - Intronic
1196785340 X:119417084-119417106 ACCAGGGCCTTGAGCCTCAAGGG + Intronic
1199610301 X:149606936-149606958 ATCAGGGACTTGAGCATCCATGG - Intronic
1199743907 X:150759982-150760004 AGCAGGGTCCTGAGCCTCACGGG + Intronic
1200283944 X:154803023-154803045 ACAAGGACCTTGAGCCACACTGG - Intronic