ID: 1196787529

View in Genome Browser
Species Human (GRCh38)
Location X:119434020-119434042
Sequence TAGTAACAGTTGTAGTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196787521_1196787529 30 Left 1196787521 X:119433967-119433989 CCTGATTAAATCGCTCTGACTGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1196787529 X:119434020-119434042 TAGTAACAGTTGTAGTAGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196787529 Original CRISPR TAGTAACAGTTGTAGTAGTG TGG Intronic
901374126 1:8825384-8825406 TAATAACAGGGGTAGCAGTGGGG + Intergenic
901558609 1:10051595-10051617 TAGAAAAAGTGGTAGCAGTGTGG - Intronic
902762872 1:18595525-18595547 TAGAAAGATTTGTAGTAGTTAGG - Intergenic
903134990 1:21303307-21303329 GAGGAACATTTGTAGTGGTGGGG + Intronic
904050713 1:27636560-27636582 AAGTAACAGTGGTGGGAGTGGGG - Intergenic
908175083 1:61547506-61547528 AAGCATCAGCTGTAGTAGTGGGG + Intergenic
910077643 1:83299175-83299197 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
911701284 1:100955212-100955234 TATTTACTGTTGAAGTAGTGAGG + Intronic
912476355 1:109938697-109938719 TAATATCAGTTTTAGAAGTGAGG + Intergenic
914464231 1:147911844-147911866 TGGTACCAGTTGTAGAAATGAGG + Intergenic
915799770 1:158777762-158777784 CAGTAATAGTAATAGTAGTGAGG - Intergenic
917496513 1:175545276-175545298 TGGGAACAGTTTTAGTGGTGTGG + Intronic
919197451 1:194306031-194306053 TAGTGGTAGTAGTAGTAGTGAGG + Intergenic
919789526 1:201281965-201281987 TAGAAACAGTTTTATTATTGAGG - Intergenic
1062760840 10:17419-17441 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1065543348 10:26793043-26793065 TAGTAGCAGTGGCAGTTGTGAGG - Intronic
1066747131 10:38611908-38611930 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1067118429 10:43453607-43453629 CAGTAACATCTGTAGTTGTGTGG - Intronic
1067995227 10:51265236-51265258 TGGAGACAGTAGTAGTAGTGAGG + Intronic
1068417577 10:56744234-56744256 TCATAACAGTAGTAGTAATGAGG + Intergenic
1074985784 10:118658531-118658553 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1075982724 10:126755407-126755429 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1076513663 10:131030612-131030634 TCGTAACACTTGAAGTAATGCGG + Intergenic
1078181314 11:9013879-9013901 TAGTCACAGTTTTTCTAGTGGGG - Intergenic
1078261296 11:9711633-9711655 TGGTAGCAGTGGTAATAGTGAGG + Intronic
1078288628 11:9983565-9983587 AAGCATCAGGTGTAGTAGTGTGG - Intronic
1080865961 11:36195209-36195231 TAGTAACAGTAGGAGTATTTAGG + Intronic
1082140457 11:48603066-48603088 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1085954484 11:81374941-81374963 TTGTAACAGTTTTATTTGTGAGG + Intergenic
1088475238 11:110230870-110230892 TCATCACAGATGTAGTAGTGAGG + Intronic
1089826252 11:121280931-121280953 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1090002186 11:122971227-122971249 ATGTAACAGTTGTAGTACTATGG + Intergenic
1090757346 11:129803983-129804005 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1092693573 12:11144094-11144116 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1093020154 12:14195950-14195972 TAGCAAAAGTTGTTTTAGTGGGG + Intergenic
1094252844 12:28385924-28385946 TATTAACAGTTGGGGTGGTGTGG + Intronic
1094808573 12:34115122-34115144 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1095118454 12:38384887-38384909 AAGTATCAGCTGTAGTGGTGTGG + Intergenic
1095248152 12:39946366-39946388 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1095450912 12:42329591-42329613 TAGTAGTATTTCTAGTAGTGAGG - Intronic
1095732726 12:45522597-45522619 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1096544540 12:52328527-52328549 TAGTAACTGCTGTAGTAAAGTGG + Intergenic
1099777382 12:87151175-87151197 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1100452546 12:94721471-94721493 GAGTAACAGTTGAAGAACTGGGG - Intergenic
1101745925 12:107541559-107541581 TAGTAAAAGTTGTTGCAGTCTGG + Intronic
1102018176 12:109662293-109662315 TAGCAATAGTGGTAGTAATGGGG - Intergenic
1104337650 12:127915059-127915081 TAGTAACAGGTGTATTAATGGGG + Intergenic
1106457643 13:29941237-29941259 ATTTAACAATTGTAGTAGTGGGG + Intergenic
1107412213 13:40168445-40168467 TAATAACAGCTATAGTAATGAGG - Intergenic
1109386748 13:61639206-61639228 TAGTAAGACTTGAAGTTGTGTGG + Intergenic
1110758872 13:79208066-79208088 GAGTATCAATTGCAGTAGTGGGG + Intergenic
1113096558 13:106670984-106671006 TAGTAAGCGTTGTATTTGTGTGG - Intergenic
1113269904 13:108662289-108662311 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1113823445 13:113231986-113232008 TAGTAACAGTGGTAGGCGGGTGG - Intronic
1114030756 14:18577891-18577913 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1115518558 14:34209775-34209797 TAGTAGTAGTGGTAGTAGTGGGG + Intronic
1117254727 14:53966039-53966061 TGGAAAAAGTTGTAGAAGTGGGG - Intergenic
1117510757 14:56448644-56448666 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1117639868 14:57786403-57786425 GAGCATCAGCTGTAGTAGTGTGG - Intronic
1118650640 14:67889902-67889924 GAGAAACAGTTGTAGAAGTCTGG + Intronic
1121158132 14:91706555-91706577 TAGCAACAGTTTGAGTAGCGTGG + Intronic
1124068711 15:26371095-26371117 TAAAAACAGTTGTAGAAATGGGG - Intergenic
1125271132 15:37940016-37940038 TAGTAACAGAAGTGGTAGAGAGG - Intronic
1126572753 15:50169166-50169188 AAGCATCAGCTGTAGTAGTGTGG - Intronic
1127008181 15:54594330-54594352 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1127976362 15:64000162-64000184 TAGTAGTAGTAGTAGTAGTCAGG - Intronic
1132053665 15:98633086-98633108 TAGTAGCAGTTGGAGTAAAGTGG - Intergenic
1135606018 16:23825424-23825446 TAGTAGCAGTAGTAGTAGTATGG + Intergenic
1135650505 16:24202216-24202238 TAGTAAGAGTAGTAGTAAGGAGG - Intronic
1136735936 16:32467736-32467758 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1138668687 16:58595310-58595332 TAGTGACAGTAATAGTGGTGCGG - Intronic
1140024785 16:71276678-71276700 GAGTAACAGTTCTAAAAGTGTGG + Intergenic
1203017139 16_KI270728v1_random:361838-361860 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1203035474 16_KI270728v1_random:634996-635018 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1152953747 18:17773-17795 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1157634401 18:49136240-49136262 TAGTAACACTTGCTGTAGTAAGG - Intronic
1158059795 18:53326040-53326062 GAGTAACAGTTGGATGAGTGAGG - Intronic
1158813076 18:61059912-61059934 TAGTAACACTAGTAATAGTTTGG + Intergenic
1163361583 19:16850162-16850184 TAGTAGTAGTAGTAGTATTGTGG + Intronic
929632518 2:43479203-43479225 TAGCAACAGTAATAGTAGTTTGG - Intronic
930287947 2:49457367-49457389 TAGTAGTAGTAGTAGTAGTAGGG - Intergenic
931573650 2:63697149-63697171 TTATAGTAGTTGTAGTAGTGTGG + Intronic
931762359 2:65430080-65430102 GAGTAGCAGTAGTAGCAGTGAGG - Intronic
932059415 2:68480653-68480675 TAATAAGAGTGGTAATAGTGGGG + Intronic
933364163 2:81327621-81327643 AAGTGACAATTGTAGTAGAGGGG - Intergenic
933785990 2:85841917-85841939 TAGTAAGAGTAGTAGTAGATTGG - Intronic
935845374 2:107160472-107160494 TAGGAACAGTTGTAGGACTAAGG + Intergenic
935871956 2:107460747-107460769 TATAATCAGGTGTAGTAGTGTGG + Intergenic
936394902 2:112118109-112118131 TAGTAACAGTATTTGTAATGAGG - Exonic
936644271 2:114350550-114350572 TAGGACCTGTTGTACTAGTGAGG - Intergenic
936946603 2:117936789-117936811 TTGCAGCAGTTGCAGTAGTGTGG - Intronic
937057892 2:118954556-118954578 AAGCATCAGCTGTAGTAGTGTGG - Intronic
943609650 2:190016868-190016890 TATTAAAAGTTGGAGTATTGAGG + Intronic
945132083 2:206584363-206584385 AAGCATCAGCTGTAGTAGTGTGG + Intronic
945388928 2:209240444-209240466 TAGTAGCAGATGTTGGAGTGAGG - Intergenic
946036493 2:216746433-216746455 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1172984492 20:38972946-38972968 TAGTTACAGTTGAAGGGGTGGGG + Intronic
1173065665 20:39708252-39708274 TAGTAGTAGTAGTAGTAGTAGGG + Intergenic
1177086445 21:16711124-16711146 TAGTCACAGATGAAGGAGTGTGG - Intergenic
1177727570 21:24989244-24989266 TAGTGAGAGTTGGAGTGGTGAGG + Intergenic
1179053706 21:37913129-37913151 CAGTGACAGTTGTGGTGGTGGGG + Intronic
1180454870 22:15504947-15504969 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1180536626 22:16398216-16398238 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
950325794 3:12108655-12108677 TAGTAACAGCTGTACTCCTGAGG - Intronic
952284880 3:31958528-31958550 CAGTAACAGTTGTATTAGGATGG + Intronic
952897020 3:38084559-38084581 TAGTGGTAGTAGTAGTAGTGGGG + Intronic
958411205 3:93818531-93818553 TGGTAGCAGGTGTAGTAGTAGGG - Intergenic
958528654 3:95294531-95294553 TAGTTACAGTTTTAGTTGTTTGG - Intergenic
959799608 3:110476428-110476450 TCCTCACAGTTGTAGTACTGAGG + Intergenic
959940957 3:112080524-112080546 TAGTAGTAGTAGTAGTAGTGAGG - Intronic
965052682 3:163671180-163671202 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
967399976 3:189049633-189049655 AAGCATCAGCTGTAGTAGTGTGG - Intronic
967798046 3:193620195-193620217 TTGTTACAGGTGTGGTAGTGTGG + Intronic
970658591 4:18260043-18260065 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
972789705 4:42359127-42359149 TAGTATCAATTGCAGTAGAGAGG + Intergenic
973734604 4:53858280-53858302 AAGTAACATTTTTAGTAGTCAGG - Intronic
975180680 4:71340370-71340392 TAATAACAGTTATATAAGTGTGG - Intronic
976684246 4:87793919-87793941 TAGTGACAGTGGGAGTGGTGAGG - Intergenic
979378473 4:119978069-119978091 TAGTCACACTTGCAGAAGTGAGG - Intergenic
980168900 4:129262735-129262757 GAGCAACAGTGGTAGTAGAGGGG + Intergenic
980398070 4:132241623-132241645 TAGTAGCAGTAGTAGTAGTAAGG + Intergenic
981175441 4:141677559-141677581 TACTTGCAGTTGTAGGAGTGAGG + Intronic
982760606 4:159278649-159278671 TAGTAAGAGCTGTAGCATTGTGG + Intronic
985253601 4:188046939-188046961 AAGAAAAAGTTGAAGTAGTGTGG - Intergenic
990712801 5:58604313-58604335 AAGCATCAGCTGTAGTAGTGTGG + Intronic
993267912 5:85751226-85751248 TAGTAGGAGTTGTAGTAAAGGGG - Intergenic
994862605 5:105217540-105217562 TAGTAGCAGTGGTGGTGGTGAGG + Intergenic
996124111 5:119705945-119705967 GAGTATCAGCTGTAGTAGTATGG + Intergenic
996574192 5:124963679-124963701 TATAAACAGTGGTAGTTGTGGGG - Intergenic
1001224684 5:169933640-169933662 GAGTAACAGCTGTAGAAGTCAGG + Intronic
1001960924 5:175880060-175880082 TAGTAACAGGTGGAGTAGGCTGG - Exonic
1002813884 6:660279-660301 AAGCATCAGCTGTAGTAGTGTGG - Intronic
1003029394 6:2589077-2589099 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1003063182 6:2877865-2877887 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1003355011 6:5360245-5360267 TAGAAACAATTGTAGCAGTGTGG + Intronic
1004151299 6:13122582-13122604 TAGTGACAGTTGTTGAAATGGGG + Intronic
1004825218 6:19412523-19412545 TAGTAACAGTTGTAAAAGATTGG + Intergenic
1005577620 6:27204916-27204938 TAGTAACAGTTGTATTAATCAGG + Intergenic
1007892690 6:45310415-45310437 AAGCATCAGCTGTAGTAGTGTGG - Intronic
1013732884 6:113189872-113189894 TAGTAGTAGTAGCAGTAGTGAGG - Intergenic
1014285001 6:119487215-119487237 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1015158267 6:130122930-130122952 TATTAATAGTAGTAGTATTGTGG + Intronic
1020204155 7:6102683-6102705 TACAAGCAGATGTAGTAGTGGGG + Intergenic
1021481078 7:21117859-21117881 TATTAGCAGTTCTTGTAGTGAGG + Intergenic
1021828257 7:24574830-24574852 AAGTAACATTTTTAGTAATGCGG + Intronic
1022693255 7:32679424-32679446 TTCTAACAGTTATATTAGTGTGG - Intergenic
1022777668 7:33544698-33544720 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1023846324 7:44122847-44122869 CAATAACAGTTGAAGTACTGGGG - Intronic
1024280147 7:47711809-47711831 GAGCAACAGGTGTAGAAGTGAGG + Intronic
1026590648 7:71692299-71692321 TAATAATAGTTGTTGTAGGGTGG - Intronic
1027295412 7:76764371-76764393 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1028006327 7:85573778-85573800 TAGTCACAGTGGAGGTAGTGAGG + Intergenic
1028555759 7:92122709-92122731 TAGTAGTAGTAGTAGTAATGAGG - Intronic
1029294318 7:99527433-99527455 TAATAACAGTTCTATTAGTTAGG - Intronic
1030042381 7:105463692-105463714 TAGCAAAAGTTGTAATAGAGGGG - Intronic
1030939616 7:115629983-115630005 TAGTAGCAGTGTTAGGAGTGGGG + Intergenic
1033539467 7:142343365-142343387 CAGTAACATTGGTAGTAGTACGG + Intergenic
1037271046 8:17131063-17131085 TATTACCAGATGTAGTAGTTGGG + Intergenic
1039287466 8:36058026-36058048 TAGTAACACTTTTAGTTTTGAGG - Intergenic
1040935617 8:52778753-52778775 TGGTAACATTTGTGGTACTGAGG + Intergenic
1042304106 8:67313766-67313788 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1043168200 8:76931278-76931300 TAGTCCCAGTTGCAGCAGTGGGG + Intergenic
1043467433 8:80526005-80526027 TAGTAACATTTGCAGTAGGTTGG - Exonic
1044133325 8:88554565-88554587 TAGTAACAGATATAGCAGTGGGG - Intergenic
1045227513 8:100263978-100264000 TATTAACAGTGTAAGTAGTGGGG - Intronic
1046306159 8:112370085-112370107 TAGTAGTAGTAGTAGTAGTCAGG + Intronic
1047032394 8:120896559-120896581 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1050171835 9:2827899-2827921 TAGTAATAGTTGGGGGAGTGGGG + Intronic
1050287163 9:4115441-4115463 TTGTAACAGTTGTATGTGTGTGG + Intronic
1051362715 9:16295051-16295073 GAGCATCAGCTGTAGTAGTGTGG - Intergenic
1051472938 9:17470015-17470037 TAGTAATAGCAGTAGTAGTATGG + Intronic
1053442813 9:38129924-38129946 TGGTAATAGTTGTGGTAATGGGG + Intergenic
1055313716 9:75011863-75011885 TAATTGCAGTTGTAGTAGTGAGG - Intronic
1055905778 9:81292284-81292306 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1056492866 9:87125160-87125182 TCATAACAGGAGTAGTAGTGGGG - Intergenic
1058410435 9:104725194-104725216 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1187748420 X:22433829-22433851 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1188737975 X:33741945-33741967 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1189664752 X:43342248-43342270 TATTAACATTTGAAGGAGTGCGG + Intergenic
1190410632 X:50133863-50133885 TAGAGACAGTTGTACTAGTTAGG - Intergenic
1190448960 X:50558224-50558246 AACTATCAGCTGTAGTAGTGTGG - Intergenic
1190546258 X:51530895-51530917 TATTAACACTTGCATTAGTGTGG + Intergenic
1190577153 X:51851566-51851588 TAATAACAGTTATGGTAATGTGG + Intronic
1191067588 X:56366994-56367016 AAGCATCAGCTGTAGTAGTGTGG + Intergenic
1192914487 X:75638086-75638108 TAGCATCAGCTGTAGTACTGTGG + Intergenic
1192970079 X:76219257-76219279 TAGTAACAGTTTTATTAATTTGG + Intergenic
1193253366 X:79319313-79319335 AAGCATCAGTTGTAGTAGTGTGG + Intergenic
1193826274 X:86231280-86231302 AAGCATCAGCTGTAGTAGTGTGG + Intronic
1194081634 X:89474034-89474056 TAAAAACAGTTGCAGTAATGGGG - Intergenic
1194926884 X:99836357-99836379 AAGAATCAGCTGTAGTAGTGTGG + Intergenic
1196114815 X:111987516-111987538 TAGAAACAGTTGTTGGGGTGTGG - Intronic
1196787529 X:119434020-119434042 TAGTAACAGTTGTAGTAGTGTGG + Intronic
1197953733 X:131924020-131924042 AAGCATCAGCTGTAGTAGTGTGG - Intergenic
1198206824 X:134473639-134473661 TAGTATCAGTTGTGGTATAGTGG + Intronic
1199114312 X:143972391-143972413 GAATAACAGTTGTAAAAGTGGGG + Intergenic
1200434301 Y:3130224-3130246 TAAAAACAGTTGCAGTAATGGGG - Intergenic