ID: 1196794295

View in Genome Browser
Species Human (GRCh38)
Location X:119489877-119489899
Sequence CCTCATCTGTAAAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196794288_1196794295 -8 Left 1196794288 X:119489862-119489884 CCTGAACCTCAGTTACCTCATCT No data
Right 1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG 0: 15
1: 99
2: 349
3: 811
4: 1556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196794295 Original CRISPR CCTCATCTGTAAAATGGGGA GGG Intergenic
Too many off-targets to display for this crispr