ID: 1196794797

View in Genome Browser
Species Human (GRCh38)
Location X:119493542-119493564
Sequence CTGTGGGTGGCGAGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196794797_1196794805 1 Left 1196794797 X:119493542-119493564 CCCTGTTCCCTCGCCACCCACAG No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196794797 Original CRISPR CTGTGGGTGGCGAGGGAACA GGG (reversed) Intergenic
No off target data available for this crispr