ID: 1196794805

View in Genome Browser
Species Human (GRCh38)
Location X:119493566-119493588
Sequence TAATCTCCATGACCACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196794794_1196794805 6 Left 1196794794 X:119493537-119493559 CCCACCCCTGTTCCCTCGCCACC No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data
1196794793_1196794805 9 Left 1196794793 X:119493534-119493556 CCTCCCACCCCTGTTCCCTCGCC No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data
1196794798_1196794805 0 Left 1196794798 X:119493543-119493565 CCTGTTCCCTCGCCACCCACAGG No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data
1196794796_1196794805 2 Left 1196794796 X:119493541-119493563 CCCCTGTTCCCTCGCCACCCACA No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data
1196794792_1196794805 10 Left 1196794792 X:119493533-119493555 CCCTCCCACCCCTGTTCCCTCGC No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data
1196794795_1196794805 5 Left 1196794795 X:119493538-119493560 CCACCCCTGTTCCCTCGCCACCC No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data
1196794801_1196794805 -7 Left 1196794801 X:119493550-119493572 CCTCGCCACCCACAGGTAATCTC No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data
1196794797_1196794805 1 Left 1196794797 X:119493542-119493564 CCCTGTTCCCTCGCCACCCACAG No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data
1196794800_1196794805 -6 Left 1196794800 X:119493549-119493571 CCCTCGCCACCCACAGGTAATCT No data
Right 1196794805 X:119493566-119493588 TAATCTCCATGACCACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196794805 Original CRISPR TAATCTCCATGACCACATTC TGG Intergenic
No off target data available for this crispr