ID: 1196799466

View in Genome Browser
Species Human (GRCh38)
Location X:119529736-119529758
Sequence ATCTGTTGGCTATAGATGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196799461_1196799466 15 Left 1196799461 X:119529698-119529720 CCTTTCCCTAATGTGTGTTATTG No data
Right 1196799466 X:119529736-119529758 ATCTGTTGGCTATAGATGCGTGG No data
1196799464_1196799466 9 Left 1196799464 X:119529704-119529726 CCTAATGTGTGTTATTGGCGCTT No data
Right 1196799466 X:119529736-119529758 ATCTGTTGGCTATAGATGCGTGG No data
1196799463_1196799466 10 Left 1196799463 X:119529703-119529725 CCCTAATGTGTGTTATTGGCGCT No data
Right 1196799466 X:119529736-119529758 ATCTGTTGGCTATAGATGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196799466 Original CRISPR ATCTGTTGGCTATAGATGCG TGG Intergenic
No off target data available for this crispr