ID: 1196809186

View in Genome Browser
Species Human (GRCh38)
Location X:119615060-119615082
Sequence CTTTCCTTACAGAGGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196809186_1196809193 13 Left 1196809186 X:119615060-119615082 CCTCCAGGCCTCTGTAAGGAAAG No data
Right 1196809193 X:119615096-119615118 ATGTCTGCACCCTGGCCCTTAGG No data
1196809186_1196809190 5 Left 1196809186 X:119615060-119615082 CCTCCAGGCCTCTGTAAGGAAAG No data
Right 1196809190 X:119615088-119615110 ATGCCCTGATGTCTGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196809186 Original CRISPR CTTTCCTTACAGAGGCCTGG AGG (reversed) Intergenic
No off target data available for this crispr