ID: 1196809243

View in Genome Browser
Species Human (GRCh38)
Location X:119615519-119615541
Sequence GGCCTGAAATTCCCAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196809243_1196809250 0 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809250 X:119615542-119615564 CAGCTGGAATAAAGTTGGAGGGG No data
1196809243_1196809258 17 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809258 X:119615559-119615581 GAGGGGGCGGGCACGGGGGATGG No data
1196809243_1196809256 12 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809256 X:119615554-119615576 AGTTGGAGGGGGCGGGCACGGGG No data
1196809243_1196809253 5 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809253 X:119615547-119615569 GGAATAAAGTTGGAGGGGGCGGG No data
1196809243_1196809254 10 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809254 X:119615552-119615574 AAAGTTGGAGGGGGCGGGCACGG No data
1196809243_1196809257 13 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809257 X:119615555-119615577 GTTGGAGGGGGCGGGCACGGGGG No data
1196809243_1196809259 30 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809259 X:119615572-119615594 CGGGGGATGGCAACCCATCTAGG No data
1196809243_1196809247 -2 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809247 X:119615540-119615562 CCCAGCTGGAATAAAGTTGGAGG No data
1196809243_1196809251 1 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809251 X:119615543-119615565 AGCTGGAATAAAGTTGGAGGGGG No data
1196809243_1196809249 -1 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809249 X:119615541-119615563 CCAGCTGGAATAAAGTTGGAGGG No data
1196809243_1196809245 -5 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809245 X:119615537-119615559 AGGCCCAGCTGGAATAAAGTTGG No data
1196809243_1196809255 11 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809255 X:119615553-119615575 AAGTTGGAGGGGGCGGGCACGGG No data
1196809243_1196809252 4 Left 1196809243 X:119615519-119615541 CCAGGTGTTGGGAATTTCAGGCC No data
Right 1196809252 X:119615546-119615568 TGGAATAAAGTTGGAGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196809243 Original CRISPR GGCCTGAAATTCCCAACACC TGG (reversed) Intergenic
No off target data available for this crispr