ID: 1196810768

View in Genome Browser
Species Human (GRCh38)
Location X:119627465-119627487
Sequence GTCATTCCACAGATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196810760_1196810768 23 Left 1196810760 X:119627419-119627441 CCAGGAGCCACTGTTCTAATACC 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1196810768 X:119627465-119627487 GTCATTCCACAGATTGAGGATGG 0: 1
1: 0
2: 0
3: 10
4: 150
1196810764_1196810768 16 Left 1196810764 X:119627426-119627448 CCACTGTTCTAATACCAGGGGAG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1196810768 X:119627465-119627487 GTCATTCCACAGATTGAGGATGG 0: 1
1: 0
2: 0
3: 10
4: 150
1196810766_1196810768 2 Left 1196810766 X:119627440-119627462 CCAGGGGAGATCAGAAGGTCTTA 0: 1
1: 0
2: 1
3: 2
4: 123
Right 1196810768 X:119627465-119627487 GTCATTCCACAGATTGAGGATGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196810768 Original CRISPR GTCATTCCACAGATTGAGGA TGG Intronic
900570286 1:3354952-3354974 GTCATTCCAGAGCTTGGGGGAGG + Intronic
900601326 1:3504028-3504050 CTCATTCCCCAGATGGAGGTGGG + Intronic
900836601 1:5009769-5009791 GCCATTCCCCAGTCTGAGGAGGG - Intergenic
905091694 1:35435411-35435433 GTCATTCCACCCATAGAGGGAGG - Intronic
905128553 1:35733867-35733889 GCTATTCCAAAGGTTGAGGAAGG + Intronic
906261933 1:44399178-44399200 GTTATTCTTCAGAATGAGGATGG + Intergenic
907575249 1:55520429-55520451 TTCATTCCACAGAGTCAGTAGGG - Intergenic
914716488 1:150258651-150258673 GTCGCTCCACAGAATGAAGAGGG - Intronic
917040589 1:170801833-170801855 GGTATTCCACACTTTGAGGATGG - Intergenic
917780928 1:178396171-178396193 GAATTACCACAGATTGAGGAGGG - Intronic
920051126 1:203165812-203165834 GTCATTCCAAATCTTAAGGAAGG - Exonic
920511623 1:206556500-206556522 GTCATTCCTAACATTGAGAAGGG - Intronic
921207680 1:212862368-212862390 GTCAATCCACAGAAAGAGAAGGG - Intronic
921983385 1:221283272-221283294 GACATTCAACAGAGTGAGGCAGG - Intergenic
1065174372 10:23062582-23062604 GTTATTCCAGAGACTGAGGTGGG - Intergenic
1066038981 10:31525706-31525728 ATGAATCCACAGATTGAAGAAGG - Intronic
1066062978 10:31740451-31740473 GTCATTCAGCAGAGTGAGAAGGG + Intergenic
1068290538 10:54996334-54996356 AGCATTCCCCAAATTGAGGACGG - Intronic
1070800249 10:79241047-79241069 GCCATTGCACAGAATGGGGAAGG + Intronic
1075029912 10:119016109-119016131 GTTATCCCACATTTTGAGGAAGG + Intergenic
1078100186 11:8325853-8325875 ATCATACCACAGAGTAAGGAAGG - Intergenic
1081204063 11:40254356-40254378 GTGATGCCATAGATTGTGGAGGG + Intronic
1083537008 11:63478634-63478656 GCCATACAACAGATTGAGAAGGG - Intronic
1084438153 11:69156001-69156023 GGCACACCACAGATGGAGGAAGG + Intergenic
1084837704 11:71815059-71815081 GTCATTGCATAGATTTAGCAGGG - Intergenic
1085044918 11:73347115-73347137 GCCATTCCAGAGAAGGAGGAAGG + Intronic
1088044917 11:105438510-105438532 GTCATAGGACAGACTGAGGAGGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092400993 12:8179014-8179036 GTCATTGCATAGATTTAGCAGGG + Exonic
1094659523 12:32453751-32453773 CTCATTCTTTAGATTGAGGAGGG + Intronic
1095660914 12:44734950-44734972 TTCCTTCCATATATTGAGGAAGG + Intronic
1095710908 12:45286981-45287003 GTCATTCAAGAGATTAATGATGG + Intronic
1098910441 12:76203528-76203550 GTCACTCCCCACATTGAGAAGGG + Intergenic
1100568325 12:95820340-95820362 TTCATTGAACAGATTGATGAGGG + Intronic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1103218842 12:119226087-119226109 GTCATTCTACGAATTAAGGAAGG - Intergenic
1103830679 12:123776492-123776514 GTCATTACTGAGATGGAGGATGG + Intronic
1104135067 12:125930041-125930063 GTCACTACCCAGATTGAAGATGG - Intergenic
1106151877 13:27112393-27112415 GTTACTCCACAGACTGAGGTGGG - Intronic
1107681826 13:42859718-42859740 ATCATTACACAGATGCAGGAAGG - Intergenic
1110342284 13:74406396-74406418 TTCATTCAACAGATTCAGGCTGG - Intergenic
1112208039 13:97344976-97344998 GTCATTCCATTGATGGAGGAAGG + Intronic
1114292701 14:21301563-21301585 GTTATTCGAGAGATTGAGGCAGG + Intronic
1119654133 14:76404866-76404888 GTCATTCCCCTTATAGAGGAGGG + Intronic
1121507795 14:94489885-94489907 CTCCATCCACAGAATGAGGAGGG + Intronic
1123022091 14:105404140-105404162 GTCATCTCAAAGCTTGAGGAAGG + Intronic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1134901083 16:17938639-17938661 GCAATTCCACAGATTAAGGAGGG - Intergenic
1135477585 16:22790368-22790390 GTCATTCCCAAGGTTGAGGTTGG - Intergenic
1135830716 16:25770478-25770500 CTCAGGCCACACATTGAGGAAGG + Intronic
1136319042 16:29470684-29470706 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1136433613 16:30210028-30210050 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1139084644 16:63570016-63570038 GTCTTTCAACAGATGGAGGCAGG - Intergenic
1139552631 16:67683720-67683742 GACATTCCTCAGAATGAGGGAGG + Intronic
1140207816 16:72947972-72947994 GTCATTCCACGGATTTGGGGTGG - Intronic
1141440964 16:84029313-84029335 GTCATTCCAGACCATGAGGATGG - Intronic
1148699571 17:49579486-49579508 GTCACTCCACAGCTTCAGGTTGG - Exonic
1152235180 17:79134928-79134950 GTCACAGCAGAGATTGAGGAGGG + Intronic
1160349719 18:78166501-78166523 GTCATTCCATAGTTTCAGAATGG - Intergenic
1161200252 19:3010642-3010664 GTCATTCCTCAGATTACTGATGG + Intronic
1161308435 19:3579821-3579843 GTCAATCCACAGAGGCAGGAAGG - Intergenic
1165863625 19:38922628-38922650 GTAATTCCACCTGTTGAGGAAGG + Intronic
1167794660 19:51701705-51701727 GTCATTACACAGCTTAAAGAAGG + Intergenic
928920328 2:36520253-36520275 GTCATTCCATAGCTTCAGCACGG + Intronic
930479103 2:51924752-51924774 ATCAATCCACAGATTCAAGAAGG - Intergenic
933029034 2:77302763-77302785 CTCATTCCACAGTCTCAGGAAGG - Intronic
934626523 2:95861436-95861458 ATAATCCCACAGATTCAGGAAGG + Intronic
934807035 2:97239860-97239882 ATAATCCCACAGATTCAGGAAGG - Intronic
934830471 2:97517315-97517337 ATAATCCCACAGATTCAGGAAGG + Intronic
936066664 2:109337605-109337627 GTTATTCCACCAATGGAGGATGG - Intronic
938963169 2:136361259-136361281 TTTCTTCCACAGATTGTGGAAGG + Intergenic
939563679 2:143761386-143761408 GGCATTCCACAGATAGAGAAGGG + Intronic
940291554 2:152082405-152082427 GTCATTCCTCAGAATCAGTAGGG + Intronic
943893943 2:193329266-193329288 ATAATACCACAGATTGAGAAGGG - Intergenic
944019927 2:195089910-195089932 GTCAGTCCTCAAATTCAGGATGG - Intergenic
947343404 2:229164441-229164463 GTCATTGCACTCAATGAGGATGG + Intronic
948503003 2:238408509-238408531 TTCATTCCCCAGCTTGAAGAAGG - Intergenic
1169957297 20:11118387-11118409 GACATTACTCAGAATGAGGATGG + Intergenic
1174796617 20:53527826-53527848 CTCAGTCCACAGACTGAGGGAGG + Intergenic
1179277376 21:39904682-39904704 GTCATATCAGAGTTTGAGGATGG + Intronic
1181714707 22:24716207-24716229 CTCATGCCACAGATTCTGGAAGG - Intergenic
1181825543 22:25512529-25512551 CACATTCCACTGAATGAGGAAGG - Intergenic
1182532642 22:30972424-30972446 GTCATAAGACAGTTTGAGGAAGG + Intergenic
1182955785 22:34424806-34424828 GTCATTCCTCTGCTAGAGGAAGG - Intergenic
1185010415 22:48309616-48309638 GTCATGCCACATCTTGATGAGGG - Intergenic
952196665 3:31082884-31082906 CTCATTCAGGAGATTGAGGATGG + Intergenic
952362176 3:32641662-32641684 GTCAATCCACAGAATCATGAGGG + Intergenic
952675511 3:36025739-36025761 GTCATTTCACAGAAGGAGAAAGG - Intergenic
956950053 3:74272532-74272554 TGCATTCCTCAGATTCAGGAGGG - Intronic
959425931 3:106188472-106188494 GTCACTCAACAGATTCATGATGG - Intergenic
959466088 3:106689774-106689796 TTCATTCCACAGAATGAGAGTGG - Intergenic
960861857 3:122163812-122163834 GGCATTCGACAGACTGAGGCAGG - Intergenic
964738375 3:159940012-159940034 GTCATTCAACAAATTAAGGATGG + Intergenic
965480751 3:169216432-169216454 GTCATTTCAGAGATTTGGGAAGG - Intronic
969779124 4:9382564-9382586 GTCATTGCATAGATTTAGCAGGG - Intergenic
971644351 4:29178640-29178662 GTCATTAAACACATTTAGGAGGG - Intergenic
972047391 4:34683492-34683514 GGCATTCCAGAGATTGAGGTAGG + Intergenic
974482271 4:62460669-62460691 GTCATTCCACATTCTGATGATGG + Intergenic
975418579 4:74135789-74135811 TTCATTCCAGAGATACAGGATGG + Intronic
975512082 4:75205303-75205325 TTCATTTGGCAGATTGAGGAGGG - Intergenic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
979619180 4:122779273-122779295 GTGATTCCTCAGATGGAGGTGGG - Intergenic
979710438 4:123772890-123772912 GTCACTCCACAGCTTGATAATGG - Intergenic
981429275 4:144641587-144641609 GTGATTCCACAGAGGAAGGACGG - Intergenic
984404301 4:179307442-179307464 GTCTTCCCACAGATTGAGGCAGG - Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
993774625 5:91976013-91976035 GTCTTTTCACATATTGAGGTGGG + Intergenic
994961506 5:106610315-106610337 GTCATTCCACTTATTAAGAATGG - Intergenic
995742411 5:115368830-115368852 GGCCTTCCCCAGATTGAAGATGG - Intergenic
995762613 5:115579335-115579357 TTCATTTCACAGATAAAGGAGGG + Exonic
997131459 5:131280818-131280840 GTCATACTACAGATAGATGAAGG - Intronic
998638851 5:143986928-143986950 GTTATTGTACAGATTGAGGAAGG - Intergenic
998786773 5:145719595-145719617 TTCATTACACAGATAGAAGAGGG + Intronic
1000769595 5:165336268-165336290 TAAATTCCACAGATTGAGAATGG + Intergenic
1004458100 6:15810253-15810275 ATCACTAAACAGATTGAGGAAGG + Intergenic
1005150158 6:22739758-22739780 GTTATTCGACAGATAGATGAAGG + Intergenic
1009616136 6:66009772-66009794 GGCACTGCACAGATAGAGGAGGG + Intergenic
1012549200 6:100452404-100452426 CTCATTCCGCAAATTTAGGAGGG - Intronic
1012992126 6:105936743-105936765 GTCATTCAACAGAAATAGGAAGG - Intergenic
1013240886 6:108244583-108244605 GTTATTCCAGAGATTGATGGTGG - Intronic
1015161235 6:130154152-130154174 GTCATTGGACATATTGTGGAGGG - Intronic
1016082958 6:139878198-139878220 GCCATTCCACAGGATGAGGCAGG - Intergenic
1020884016 7:13800234-13800256 GTGATTCCACAGACTTCGGAAGG + Intergenic
1021613957 7:22483312-22483334 GTTATTCCACATATGGATGAGGG + Intronic
1023277674 7:38537953-38537975 GTCCTTCCAGTGTTTGAGGATGG - Intronic
1029294077 7:99525566-99525588 GTCATTCCACTGAACGAAGAGGG - Intronic
1030450239 7:109700042-109700064 GTGATAACCCAGATTGAGGATGG - Intergenic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032380347 7:131473221-131473243 ATCATTCCACTCATTGAGAAGGG + Intronic
1033171625 7:139089594-139089616 GTGATTCCTCAGTTTAAGGAGGG - Intronic
1035948752 8:3994964-3994986 GTCATTCCACAGAGCCAGGAGGG - Intronic
1036276557 8:7356525-7356547 GTCATTGCATAGATTTAGCAGGG - Exonic
1036295768 8:7535805-7535827 GCCATTACACAGATTTAGCAGGG + Intergenic
1036326799 8:7785215-7785237 GCCATTACACAGATTTAGCAGGG - Intergenic
1036344779 8:7953821-7953843 GTCATTGCATAGATTTAGCAGGG + Intergenic
1036560466 8:9897259-9897281 GTCATTCCACATTTCAAGGAGGG - Intergenic
1036840120 8:12114588-12114610 GTCATTGCATAGATTTAGCAGGG + Exonic
1036861908 8:12360825-12360847 GTCATTGCATAGATTTAGCAGGG + Intergenic
1036963423 8:13270582-13270604 CTGATTCCACACATTGATGAGGG - Intronic
1037566124 8:20119873-20119895 CTCATTCAACAGATTTAGGAGGG - Intergenic
1039676923 8:39678376-39678398 GTAATTTCACATATGGAGGAGGG - Intronic
1039811433 8:41052797-41052819 TTCATACCAGAGATTCAGGATGG + Intergenic
1047193264 8:122698108-122698130 GTCATTACACTGCTTAAGGAAGG - Intergenic
1048916768 8:139191660-139191682 TGTATTCAACAGATTGAGGAAGG + Intergenic
1048957151 8:139546636-139546658 GACATTCCTCAGACTGAGGTAGG - Intergenic
1049296221 8:141841065-141841087 GTAATTCCACATGTTGAGGGAGG + Intergenic
1051590543 9:18772923-18772945 GAGATTCCAAACATTGAGGAGGG + Intronic
1057002019 9:91518891-91518913 GGCATTCCACAAATTAAGAAAGG + Intergenic
1060377725 9:123132557-123132579 GATATTCCATAGATTGAGAAGGG - Intronic
1061139043 9:128753244-128753266 GTCTTTCCACTGGGTGAGGAAGG + Exonic
1061141438 9:128769850-128769872 GTCATTACAAAGATGGAAGAAGG + Intronic
1185886351 X:3786815-3786837 GCCATTCCAGAGACTGAGGCGGG - Intergenic
1186230197 X:7445389-7445411 GTCATTCCACAGAGGTGGGATGG - Intergenic
1190553229 X:51606713-51606735 GCTATGCCACAGATTTAGGATGG - Intergenic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1195588673 X:106598599-106598621 GATTTTCCACAAATTGAGGAAGG - Intergenic
1195879420 X:109576769-109576791 GTGATGCCACACATTGGGGAGGG - Intergenic
1196810768 X:119627465-119627487 GTCATTCCACAGATTGAGGATGG + Intronic