ID: 1196811848

View in Genome Browser
Species Human (GRCh38)
Location X:119635151-119635173
Sequence TTGGGCAACCAGGTGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 2, 1: 2, 2: 11, 3: 32, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196811838_1196811848 17 Left 1196811838 X:119635111-119635133 CCCAGGACTTGGGAGGAGCCAAA 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1196811848 X:119635151-119635173 TTGGGCAACCAGGTGGATGGTGG 0: 2
1: 2
2: 11
3: 32
4: 270
1196811839_1196811848 16 Left 1196811839 X:119635112-119635134 CCAGGACTTGGGAGGAGCCAAAG 0: 1
1: 0
2: 2
3: 21
4: 272
Right 1196811848 X:119635151-119635173 TTGGGCAACCAGGTGGATGGTGG 0: 2
1: 2
2: 11
3: 32
4: 270
1196811841_1196811848 -1 Left 1196811841 X:119635129-119635151 CCAAAGGTAATTCTGATTATCCT 0: 1
1: 0
2: 2
3: 25
4: 230
Right 1196811848 X:119635151-119635173 TTGGGCAACCAGGTGGATGGTGG 0: 2
1: 2
2: 11
3: 32
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196811848 Original CRISPR TTGGGCAACCAGGTGGATGG TGG Intronic
900024415 1:207463-207485 TCGGGCAACCATTTGGACGGTGG + Intergenic
900875546 1:5340187-5340209 TTGGGAATCCAGATGGGTGGGGG + Intergenic
901957670 1:12798079-12798101 TTGGGCAACATGGTTGGTGGTGG + Intergenic
902391516 1:16109805-16109827 TTGGGGATCCAGGTGTAGGGAGG - Intergenic
902544948 1:17184344-17184366 TTGGGGATCCTGGTGGCTGGTGG + Intergenic
903173682 1:21568670-21568692 CTGGGCAAGTAGGAGGATGGAGG + Intronic
905799501 1:40834258-40834280 TTGGGTGACCAAGTGGATGGTGG - Intronic
906669238 1:47642824-47642846 GTGGGGCACCTGGTGGATGGTGG + Intergenic
907135897 1:52139455-52139477 TTGGGCATCTGGGTGGATGATGG + Intergenic
907195135 1:52680454-52680476 TTGGGCATCTAGGTGGACAGTGG - Intergenic
908155580 1:61349463-61349485 TTGGGAAACCAGGTGAATTGAGG - Intronic
908292813 1:62685777-62685799 TTGGGCAACCACGTGGATGATGG - Intronic
908503331 1:64767882-64767904 TTGGGCACCCAAGTGGATAGAGG + Intronic
908924518 1:69238386-69238408 TTGGTCAAGTAGGTGAATGGTGG + Intergenic
911072474 1:93843098-93843120 TTGGGAAACCATGTGGTGGGTGG + Intronic
911675610 1:100655225-100655247 TTGGGCAACAGGGTGAATGCTGG + Intergenic
912134013 1:106637007-106637029 TAGGGCAGCCAGGTGGTTCGGGG - Intergenic
912172348 1:107116202-107116224 TTGGGCAACTGGTTGGATAGTGG + Intergenic
913483208 1:119309516-119309538 ATAGGCACCCAGGTTGATGGGGG - Intergenic
914376965 1:147080312-147080334 TTTGGACACCAGATGGATGGAGG + Intergenic
915145593 1:153794304-153794326 TTGGGGAAGCAGAGGGATGGAGG + Intergenic
915185075 1:154098598-154098620 TTGGGCAACCAGCTGCAGAGAGG - Intronic
916233443 1:162562019-162562041 CTGGGCAGCCGGGTGGATGGCGG + Intronic
916479428 1:165201814-165201836 GTGGGGAACCAGGGGGATGTGGG - Intergenic
917960851 1:180143161-180143183 TTGGGGAAGCAGGGGGATAGGGG + Intergenic
918313868 1:183306483-183306505 TTGGGCATCCTGGTTGAGGGAGG - Intronic
920432954 1:205930353-205930375 TTGGGCAACCAGGTTAATGATGG - Intronic
920526148 1:206668042-206668064 TTTGGCAACCAGATGGAGAGTGG + Intronic
921618090 1:217295734-217295756 TGGGAGAACCAGGTGGAGGGAGG - Intergenic
924154244 1:241159763-241159785 TTATGCAGCCAGGTGGATGAGGG + Intronic
1064033179 10:11895769-11895791 TTTTGCAACAACGTGGATGGAGG - Intergenic
1065182477 10:23140405-23140427 TTAGGCAACCAGATTGGTGGTGG + Intergenic
1067731695 10:48817384-48817406 TTGGGCTCCCAGGGGGAAGGCGG - Exonic
1068465648 10:57387205-57387227 CTGGGCAACCAGGAGACTGGTGG + Intergenic
1074140586 10:110668579-110668601 TTGGGACAACAGGTGGAGGGAGG + Intronic
1074266544 10:111909931-111909953 TGAGGCCACCAGGTGGAAGGAGG + Intergenic
1074954753 10:118377612-118377634 TGGGGCACCCAGGTGGGTGTAGG + Intergenic
1076063177 10:127429066-127429088 TTGGGGTACCATGTGGATTGGGG + Intronic
1077347771 11:2072083-2072105 ATGTGCAACCAGGTGGCTAGAGG - Intergenic
1077512376 11:2975065-2975087 TGGGGAAACCAGCTGGAAGGTGG + Intronic
1078073047 11:8131354-8131376 TTGGGCAACCAAGTGGATGGTGG + Intronic
1078738179 11:14041188-14041210 TTGGGGAAGAAGGAGGATGGGGG - Intronic
1079545211 11:21625762-21625784 TTGTGCAATCAGGTGTATTGTGG + Intergenic
1080440992 11:32294427-32294449 GTGGGCAAGTAGGTGGATAGAGG + Intergenic
1081555031 11:44151147-44151169 TTGGACAACTATGAGGATGGGGG - Intronic
1081615372 11:44587655-44587677 CTGAGCCACCAGGTGGGTGGAGG + Intronic
1081625830 11:44654546-44654568 TTGGGCAACCAGGTGGGGAATGG - Intergenic
1081988103 11:47321813-47321835 TGGGGCAGCTGGGTGGATGGTGG + Intronic
1082762544 11:57141728-57141750 TTGTGCAACTGGGTGGAGGGCGG + Intergenic
1083580478 11:63821697-63821719 ATGGCCAACGAGGTGGCTGGAGG + Intronic
1084450405 11:69233443-69233465 TTGGGCAACCAAGTGGCAGATGG + Intergenic
1086158661 11:83696093-83696115 CTTGGCAACCAGGTGGAGGATGG + Intronic
1086931729 11:92700670-92700692 TAGGGCAACGAGGTTGCTGGAGG - Intronic
1087841754 11:102927795-102927817 TTGGGCAACCAGCTGGGTGGAGG + Intergenic
1088629198 11:111757933-111757955 TTGAGCAACTGGGTGGATGATGG - Intronic
1089141725 11:116290454-116290476 TTGAGCAACTGGGTAGATGGTGG - Intergenic
1090397423 11:126428334-126428356 TTGGACAACTAGGTAGATGATGG + Intronic
1090999188 11:131894195-131894217 TTAGGCAAGCATGTGGCTGGCGG - Intronic
1091079243 11:132651072-132651094 TTGGGGCAGCAGGTGGATGCTGG - Intronic
1091378113 12:38998-39020 TCGGGCAACCATTTGGACGGTGG + Intergenic
1091831899 12:3556008-3556030 TTGGGCAACTGGGTGGATGGTGG + Intronic
1097708020 12:62888203-62888225 TTCATCAACTAGGTGGATGGTGG + Intronic
1097722978 12:63043889-63043911 TTGAGGAATTAGGTGGATGGTGG - Intergenic
1100930201 12:99599686-99599708 TTGGGCAACTGGGTGGATAGTGG + Intronic
1102436633 12:112929288-112929310 TTGGGAAGCCAGCTGGATTGAGG + Intronic
1102642718 12:114381140-114381162 TTGGGCCAAGAGGTAGATGGGGG + Intronic
1103371885 12:120425396-120425418 GTTGACAGCCAGGTGGATGGAGG + Intergenic
1104579507 12:130000207-130000229 ATGGGCAAGGAGGTGGAGGGCGG - Intergenic
1105287215 13:19014191-19014213 ATGTGAAACCATGTGGATGGAGG - Intergenic
1105345475 13:19567324-19567346 CTGGGGAAACAGGTTGATGGAGG + Intergenic
1105995717 13:25669984-25670006 TAGGGCAGCCATGGGGATGGTGG - Intronic
1106013508 13:25846843-25846865 TTGTGCAACCAGGTGGAGAAGGG - Intronic
1107676379 13:42802119-42802141 TTGAGTAACCAAGTGCATGGTGG - Intergenic
1108533126 13:51345977-51345999 TTGGGTAACTGGGTGGATGGTGG + Intronic
1109187245 13:59284770-59284792 TTAGGCAACTGGGTGGATGGTGG + Intergenic
1109304117 13:60619918-60619940 TTGGGCAGCTGGGTGGATAGTGG - Intergenic
1110721976 13:78772231-78772253 TTGGGTAACCAGGTAAATGGGGG + Intergenic
1112128030 13:96491604-96491626 TTGGGAATGCAGGTGGGTGGTGG - Intronic
1112543814 13:100344282-100344304 TTGGAAGACCTGGTGGATGGTGG + Intronic
1114707577 14:24743051-24743073 ATGGGCAACTAGGTGGATGGTGG - Intergenic
1117869508 14:60185712-60185734 TTGGACAACCATGTGAATAGTGG - Intergenic
1121434616 14:93910902-93910924 TTGGGCAAGCAGGCAGGTGGTGG - Intergenic
1121586188 14:95064573-95064595 TTGGGCAACTGGGAAGATGGTGG + Intergenic
1122072109 14:99211634-99211656 TCGAGGAACCAGGTGGAGGGGGG - Intronic
1122411169 14:101526924-101526946 TTGCACAACCAGGAGGATAGTGG + Intergenic
1122481279 14:102049078-102049100 TGGGGCAAACAGGAGGATGCTGG - Intronic
1124014664 15:25864559-25864581 CTGGGCAACATTGTGGATGGTGG - Intronic
1125417737 15:39470856-39470878 TTGAGCAACCAGTTATATGGTGG - Intergenic
1125428722 15:39575543-39575565 TTGGGGAACTAGGGGGATTGGGG + Intergenic
1125452420 15:39823383-39823405 ATGAGCAACCAGGGGGATGGAGG - Intronic
1126645077 15:50867742-50867764 TTGGCCAAGAAGGGGGATGGAGG - Intergenic
1127908404 15:63394963-63394985 CTGGGCAACTAGGAGGATGATGG - Intergenic
1127940328 15:63688829-63688851 TTGGGAAACTAGGTGAATGGTGG + Intronic
1127980914 15:64034358-64034380 TGGGGCAGCCATGTTGATGGGGG - Intronic
1128445739 15:67758334-67758356 TTGGGCAGTCAGGTGCATGGTGG + Intronic
1129689690 15:77706202-77706224 TTGGGCAGCTGGGTTGATGGTGG - Intronic
1129803634 15:78436691-78436713 TTGGGCAACCAGGTGGATGGTGG + Intergenic
1131111552 15:89767783-89767805 GTGGGCAGCCAGGTGGCTGCAGG + Intronic
1131573537 15:93563696-93563718 TCTGGCAACCAGGTAGATGAAGG - Intergenic
1132128766 15:99253938-99253960 TTGAGCCACTGGGTGGATGGAGG + Intronic
1132931135 16:2459862-2459884 TTGGGTAACTGGGTAGATGGGGG - Intergenic
1132984274 16:2756175-2756197 TTGGGAGACCAGGAGGATGGTGG + Intronic
1133256209 16:4517990-4518012 TTGGGCCACTTGGTGGACGGTGG - Intronic
1133823605 16:9258394-9258416 TTGGGCTCCCAGGAGGAAGGAGG - Intergenic
1135829938 16:25764076-25764098 TTAGGCAACTGGGTGGAAGGTGG + Intronic
1135984991 16:27177643-27177665 ATGGTCACCCAAGTGGATGGAGG - Intergenic
1137983204 16:53086993-53087015 TTAGGGCACCAGGTGCATGGTGG - Intronic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1139923384 16:70473101-70473123 CTGGACCACCAGGAGGATGGGGG + Exonic
1140450885 16:75069931-75069953 TTGGGCAACTGGGTAAATGGTGG - Intronic
1141967220 16:87453549-87453571 TGGGGCAGCCAGGTGTGTGGCGG - Intronic
1143167833 17:4907055-4907077 GTGGGCAGGTAGGTGGATGGTGG + Intergenic
1143451323 17:7038506-7038528 ATGGGCCACCAGGTGGAGGTAGG - Exonic
1144165772 17:12608942-12608964 TTGGGCAACTGGGTGGGTGGGGG + Intergenic
1144456444 17:15422788-15422810 CTGGGCATCTAGATGGATGGTGG + Intergenic
1145013407 17:19382282-19382304 CTGGGCAGCCAGGAGGCTGGTGG - Exonic
1145754479 17:27380748-27380770 GTGGGGAGCCAGGGGGATGGCGG + Intergenic
1146666904 17:34711248-34711270 TTGGGGAACCAAGCAGATGGGGG - Intergenic
1147812204 17:43180442-43180464 TTGGTCAACCATGTGTATGATGG - Intronic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1150733047 17:67712426-67712448 TTGAGTGACCAGGTGGATTGGGG - Intergenic
1152267715 17:79305936-79305958 TTGTGCAAGCCAGTGGATGGAGG + Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153145540 18:2027503-2027525 TTGGGAACCCAGGCTGATGGAGG - Intergenic
1153828203 18:8896664-8896686 CTGGGCAACTCTGTGGATGGTGG - Intergenic
1155068073 18:22285711-22285733 TTAGGCAACTGAGTGGATGGGGG + Intergenic
1156522364 18:37732534-37732556 TTGAGCAACTAGGTATATGGTGG - Intergenic
1157212359 18:45754475-45754497 TTGGGCTACAAGGTGAATGGTGG + Intergenic
1158095258 18:53763176-53763198 TTGTGAAACCTGGTGTATGGTGG - Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159936897 18:74376192-74376214 ATGGGCAAGCAGGTGGATGATGG + Intergenic
1160094162 18:75855968-75855990 ATGGGCAGACAGATGGATGGCGG - Intergenic
1161056067 19:2191163-2191185 CTGGGCCACCAGGTCGAAGGAGG - Exonic
1161387980 19:4007183-4007205 CTCGGCAACCAGCTGGCTGGGGG - Intergenic
1161971330 19:7582549-7582571 TTTCGCAAGCAGGTAGATGGTGG - Intergenic
1163166198 19:15499786-15499808 TTGGGCAGGCAGGTGGAGGGAGG - Intergenic
1164437394 19:28242751-28242773 TTGGGCAAACAGCTCTATGGCGG - Intergenic
1164735730 19:30539688-30539710 TTGGGAAGCCAGGTGCCTGGGGG + Intronic
1164755439 19:30685720-30685742 AGAGGCAACCAGGGGGATGGGGG + Intronic
1165697134 19:37909054-37909076 TTAGGCAACCAGGTCAATGCTGG - Intronic
1166228570 19:41412272-41412294 GTGGGCAAGCAGGTGGATGGTGG - Intronic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
1167014929 19:46835013-46835035 TTGGAGAACCTGGGGGATGGTGG - Intergenic
1167204714 19:48093221-48093243 TTCTGCAACCTGGTAGATGGAGG - Intronic
1167571220 19:50290256-50290278 TTGGGGAAGGATGTGGATGGAGG - Intronic
1168298350 19:55388869-55388891 ATGGGCAACTTGGTGGGTGGTGG + Intronic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926203665 2:10819701-10819723 CTGGGCTACGAAGTGGATGGAGG - Intronic
926299156 2:11589835-11589857 CTGAGCAGCCAGGTGAATGGTGG + Intronic
926593043 2:14759956-14759978 TTTGGAAACCAGGTGGCTTGGGG - Intergenic
926960544 2:18353893-18353915 TCTGGCAAGCACGTGGATGGAGG - Intronic
929036677 2:37699762-37699784 TTTGGCAGCCAGGTGGAGGATGG + Intronic
929585963 2:43114676-43114698 TTGAGTAGCCAGGTGGGTGGTGG - Intergenic
929982769 2:46697523-46697545 TTGGGCAAATAAGTGGATGGTGG + Intergenic
930130972 2:47850204-47850226 TTGGGCAATCCAATGGATGGTGG + Intronic
930599199 2:53424324-53424346 TTGGGCACAGAGGGGGATGGCGG - Intergenic
930835204 2:55785528-55785550 TTGGACAACTGGGTGCATGGTGG - Intergenic
931609310 2:64081557-64081579 TTAGGCAATTAGATGGATGGTGG - Intergenic
931783178 2:65597538-65597560 TTTAGAATCCAGGTGGATGGAGG + Intergenic
932612433 2:73209859-73209881 TTGAGTAACCAGGTGGACGGTGG - Intronic
932998121 2:76882784-76882806 TTGTGAGACCTGGTGGATGGTGG - Intronic
935007145 2:99089814-99089836 TTCAGCTACCAGGTGGATAGAGG - Intronic
937568677 2:123330418-123330440 GTGAACAACCACGTGGATGGGGG + Intergenic
940005901 2:149009435-149009457 TAGGGGACCCAGATGGATGGAGG - Intronic
940327740 2:152443165-152443187 ATGGGGAACCAGATGGGTGGTGG + Intronic
941377172 2:164746183-164746205 TTGGTGATCCAGGTGGTTGGTGG - Intronic
943398409 2:187371979-187372001 TTGGTCTACCAGTTGGATAGAGG + Intronic
945144869 2:206727615-206727637 TTGAACAACCAGCTGGATGATGG - Intergenic
946374446 2:219299629-219299651 TTGAGCAAGGAGGTGGCTGGAGG - Intronic
946925605 2:224623936-224623958 TTGGGCAACCAGGTGGTGTCAGG + Intergenic
947732287 2:232438004-232438026 TTGGGCCACCAGGGAGGTGGAGG + Intergenic
1169369310 20:5016382-5016404 TTGGGCAGCCAGGTGGACGAGGG + Intergenic
1169834815 20:9866319-9866341 TTGGGGAACTGGGTAGATGGTGG + Intergenic
1169949889 20:11032224-11032246 CTGGGAAACCAGTGGGATGGTGG + Intergenic
1170795268 20:19541559-19541581 TTGGGATTCCAAGTGGATGGGGG - Intronic
1170858338 20:20078390-20078412 CTTGGCTACCAGTTGGATGGAGG + Intronic
1172624637 20:36340212-36340234 TTGGGCAGCCAGGAGAAGGGAGG - Intronic
1173400804 20:42724318-42724340 TTGGGCCTCCAGGTGCATGAGGG - Intronic
1173895145 20:46545520-46545542 TGGAGCAGCCAGGTGGGTGGAGG + Exonic
1175415388 20:58797423-58797445 ATGGCCAGCCAGGTGGACGGAGG - Intergenic
1175758978 20:61548315-61548337 TCGGGCAGGCAGGTGGAAGGAGG + Intronic
1177048484 21:16201543-16201565 TTGTGCAACCAGGTGGATGATGG - Intergenic
1177192673 21:17869285-17869307 TTAGGAAACTAGGTGGATGATGG + Intergenic
1178871205 21:36378091-36378113 TGGGGCAAGCAGGGGGAGGGAGG + Intronic
1179555185 21:42169941-42169963 CTGGGCAAGCAGGTTGATAGTGG + Intergenic
1180835368 22:18926996-18927018 TTGAGCAGCCAGGTGGAAAGTGG - Intronic
1181142115 22:20813491-20813513 TCGGGCAAGCAGGAGGCTGGTGG + Exonic
1181496774 22:23291742-23291764 TTGGCCATGCGGGTGGATGGTGG - Intronic
1182928957 22:34154677-34154699 TTGAACAATTAGGTGGATGGTGG + Intergenic
1184878093 22:47288278-47288300 ATGGACAGGCAGGTGGATGGAGG - Intergenic
1203285456 22_KI270734v1_random:152295-152317 TTGAGCAGCCAGGTGGAAAGTGG - Intergenic
950679304 3:14573995-14574017 CTTGGCACCCAGGTGGATGAGGG + Intergenic
951581562 3:24170173-24170195 TTAAGCTCCCAGGTGGATGGTGG - Intronic
952930393 3:38355777-38355799 TTCAGGAACCAGGTTGATGGTGG - Intronic
955032355 3:55233569-55233591 TTGGGCAAATGGGTAGATGGTGG - Intergenic
956258780 3:67314029-67314051 TTGGGCATCCAAGTGGATCTTGG - Intergenic
957994801 3:87675831-87675853 TTGAGCAAGCAGGTGGAAAGTGG - Intergenic
960280988 3:115781316-115781338 TTGAGAAACCGGGTGGATGCAGG + Intergenic
960316679 3:116186954-116186976 AGGGGCAACCAGGTGGTGGGAGG + Intronic
961085022 3:124059942-124059964 TTTGGGAACCATGGGGATGGTGG + Intergenic
961487647 3:127227794-127227816 TTGGGCCCCCAGGTCGCTGGAGG - Intergenic
962083469 3:132165576-132165598 TTGAGCAACCAAGCGGAGGGCGG - Intronic
962935637 3:140078028-140078050 TTGGGTAACACGGTGGATGAGGG + Intronic
963312976 3:143728839-143728861 TCTGGCAACGAGATGGATGGTGG + Intronic
963492714 3:146021262-146021284 TTTGGCAGCCAGGAAGATGGAGG - Intergenic
966937366 3:184719806-184719828 TTGGGCCAGAAGGTGGTTGGAGG - Intergenic
968995631 4:3943661-3943683 CTGGGCAGCCAGGTAGATGTGGG - Intergenic
969298160 4:6281565-6281587 TGGGGCTGCCAGGTGGACGGTGG + Intronic
969560100 4:7941357-7941379 CTGAGCAGCTAGGTGGATGGAGG - Intergenic
969954998 4:10880055-10880077 TTGAGCCCCCAGGTAGATGGTGG - Intergenic
970176980 4:13349365-13349387 TTGGGCAACTAGCTAGGTGGTGG + Intergenic
972090310 4:35273238-35273260 ATGGGCAACCAGGGTGATGGAGG + Intergenic
972350619 4:38233018-38233040 TAGGGCCACCAGTTGGGTGGGGG - Intergenic
972420732 4:38883858-38883880 TTGGACAACCAGGTGGATGGAGG + Intronic
972774308 4:42227415-42227437 CTGGGCAAGCTGGTGGAGGGAGG - Intergenic
975493230 4:75011406-75011428 CTGCGCAACCGGGTGAATGGGGG + Intronic
975605450 4:76149692-76149714 TTGGGCAAGTTGGTGAATGGTGG + Intergenic
975802806 4:78079979-78080001 TAGGCCAACCAGGCAGATGGCGG - Intronic
976260718 4:83142331-83142353 TTCAGCAGCCAGGTGGAGGGTGG + Intergenic
977283428 4:95070392-95070414 TTTGGCAGCTGGGTGGATGGCGG + Intronic
977791828 4:101113797-101113819 TTGGGTAACCAAGAAGATGGAGG - Intronic
977954734 4:103013725-103013747 TTGAGCAACTAGGTCGATGGTGG - Intronic
980007576 4:127559361-127559383 ATAGGCACCCAGGTGGAAGGGGG + Intergenic
981011504 4:139929979-139930001 ATGGGAAAGCAGGTGGATGCAGG - Intronic
981236242 4:142419084-142419106 TTGAGTAACTAAGTGGATGGTGG + Intronic
988700876 5:33673438-33673460 TTGGGCAACTGAGTCGATGGTGG - Intronic
991144506 5:63284853-63284875 TTGGGAAACTAGGTGGCTGCAGG + Intergenic
991298557 5:65105512-65105534 TTGGGCAAATAGGAGGATGTGGG - Intergenic
993643215 5:90431435-90431457 TAGAGCAACTAGGTGGATGGTGG + Intergenic
993823480 5:92650809-92650831 TTGGGAATCCAGGTGGATGGAGG - Intergenic
998904774 5:146893407-146893429 TGGGGCAGCTAGGTCGATGGTGG - Intronic
999740038 5:154542933-154542955 TAGGGATACCAGGTGGAAGGTGG - Intergenic
1000042740 5:157497131-157497153 TTGGGCAACAGGGTTGAGGGTGG - Intronic
1001053097 5:168428275-168428297 TTGGGCAGCCAAGAGGAAGGTGG - Intronic
1001931065 5:175673353-175673375 CTGAGCAACCAGGTGTTTGGAGG + Intronic
1002058453 5:176612004-176612026 TTGGGGAGCCAGGTGGATGAAGG + Intergenic
1002060680 5:176624023-176624045 TTGGGCCACCAGCGGCATGGGGG - Intronic
1002079825 5:176730898-176730920 TTAGGGAACCAGGCTGATGGAGG - Intergenic
1003692335 6:8366965-8366987 TTGGGAAACCGGGTGGATATTGG + Intergenic
1004252686 6:14034916-14034938 TTGGGGAAATGGGTGGATGGTGG + Intergenic
1004442189 6:15664017-15664039 TTGAGCAAATTGGTGGATGGTGG - Intergenic
1004525056 6:16399779-16399801 TTGGGGAAGCAGGGAGATGGAGG - Intronic
1006189245 6:32197422-32197444 TCGGGCAGCCAGGTGCAGGGGGG + Exonic
1007142362 6:39588704-39588726 TTGAGCAACCGGGTTGATGTTGG - Intronic
1009387244 6:63099936-63099958 TGTGGCAAGGAGGTGGATGGTGG + Intergenic
1011320114 6:86081322-86081344 TTGGGCATCCAGGTGTCTGGAGG + Intergenic
1011411588 6:87071860-87071882 TTGGGGACCCAGGTTCATGGAGG + Intergenic
1011553621 6:88551679-88551701 TTGTGCAACCACGTGGATCAAGG - Intergenic
1011788374 6:90870979-90871001 TTGGGCAATAGGTTGGATGGTGG - Intergenic
1012961865 6:105630555-105630577 TTGGGACACTAGGTGAATGGTGG + Intergenic
1013697690 6:112723616-112723638 TTGAGCAAAAAGTTGGATGGAGG + Intergenic
1015510615 6:134034732-134034754 TTGGGCAGCCACGTGGACTGAGG + Intronic
1015545862 6:134360615-134360637 TTGAGCAACTAGGTGAATAGTGG - Intergenic
1015577685 6:134690250-134690272 TTAGTCCACCAGGTGGCTGGGGG - Intergenic
1016004056 6:139071251-139071273 TTTGGCTACTAGGTGGATGTGGG + Intergenic
1016505007 6:144769449-144769471 TTTGGCAAACAGATGGAGGGAGG - Intronic
1017144736 6:151224423-151224445 TGGAGCATCCTGGTGGATGGAGG - Intergenic
1017713881 6:157194017-157194039 TTGGCCAATCAGATGGAAGGGGG + Intronic
1019655979 7:2196035-2196057 GTGGCCAGCCAGATGGATGGAGG + Intronic
1020923549 7:14295676-14295698 TCTTGGAACCAGGTGGATGGAGG - Intronic
1023874925 7:44281769-44281791 TTGGACAAGCAGGTGGGAGGAGG - Intronic
1026153698 7:67809598-67809620 TTGAGCAATTGGGTGGATGGTGG - Intergenic
1026907238 7:74069417-74069439 CAGGTCAACCAGGTTGATGGTGG - Intronic
1028923852 7:96336462-96336484 TTGGGTAACGAGGTGGCTAGTGG - Intergenic
1029431868 7:100536501-100536523 TTGGGCAACTAGGTGGCTCATGG + Intergenic
1030884178 7:114918959-114918981 TTCTGCATCCAGGTTGATGGTGG - Intergenic
1031077055 7:117223039-117223061 TTGAGCAACGGGGTGGATGGCGG - Exonic
1034545162 7:151784617-151784639 TTGGGCCACCATGAGGGTGGGGG + Intronic
1035048570 7:155984779-155984801 CTGGGCCACCAGGTGCATGCTGG - Intergenic
1035671839 8:1424025-1424047 TCAGGCAGCCAGTTGGATGGAGG + Intergenic
1035672098 8:1425949-1425971 TATGGAAACCAGGTGGCTGGAGG + Intergenic
1035706970 8:1683275-1683297 TTGGTCAAGGTGGTGGATGGTGG + Intronic
1036589211 8:10152545-10152567 TTGGGTATCTAGGTGGATTGGGG + Intronic
1036595725 8:10210259-10210281 TTGGCCAAGGAGGTGGTTGGTGG + Intronic
1038072166 8:24029027-24029049 TTGAGCAACAAGGTAGATGGTGG + Intergenic
1038962754 8:32539451-32539473 TGGGGGCACCAGGTGGCTGGAGG + Intronic
1039137561 8:34342639-34342661 TTGGTCAACTAGGTGAATGTTGG + Intergenic
1041255478 8:55976681-55976703 GTGGGCTAGCAGGTGGAAGGTGG + Intronic
1041318952 8:56593942-56593964 TTGAGCAACTAGGTGGATGGAGG + Intergenic
1044477197 8:92641511-92641533 TTTTGCAACAAGGTGGAAGGTGG - Intergenic
1047527638 8:125647127-125647149 TTGGCCAGCAAGGTGGAGGGAGG + Intergenic
1047556451 8:125936725-125936747 TTAGGAAAACAGGTGGAGGGTGG + Intergenic
1047735731 8:127763412-127763434 TTTGACAACCAGGGGGCTGGAGG - Intergenic
1048064039 8:130949706-130949728 TGGGGCAAGGAGGTGGAGGGCGG - Intronic
1049695752 8:143983635-143983657 TGTGGCACCCAGGTGGCTGGAGG - Exonic
1050490747 9:6185458-6185480 TTGGGCAATAGAGTGGATGGTGG + Intergenic
1050704726 9:8384244-8384266 CTGGGCAACCACATGGAAGGAGG - Intronic
1051648813 9:19299445-19299467 TTTGGTAACTGGGTGGATGGTGG + Intronic
1052355682 9:27502755-27502777 TTGGGCATCCTGGTGGATTGAGG - Intronic
1054447792 9:65386135-65386157 CAGGGCTACCAGGTCGATGGAGG + Intergenic
1055045858 9:71923143-71923165 TATGGAAACCAGATGGATGGTGG - Intronic
1056454665 9:86748313-86748335 TTTAACAACCAGGTGGATGATGG - Intergenic
1057096824 9:92318194-92318216 GTGGGCAAGCACGAGGATGGTGG - Intronic
1058892379 9:109372101-109372123 TTGGGCAACTGTGTGGATGTTGG - Intergenic
1059388079 9:113980765-113980787 GTGAGCAACCAGCTGGATGGAGG + Intronic
1059747807 9:117219903-117219925 TGGGGAAACCAGGTGCCTGGGGG + Intronic
1060149571 9:121279609-121279631 CTGGTCCACCGGGTGGATGGTGG + Intronic
1060838409 9:126775717-126775739 TTGGCCAACCAGTTGTATGGTGG - Intergenic
1060879955 9:127111111-127111133 AAGGTCAACCAGGTGGTTGGAGG - Intronic
1062155597 9:135046511-135046533 TTAGCAAACCAGGTGCATGGTGG + Intergenic
1185641760 X:1592393-1592415 TTGGGCAGCCAGGTGTACCGGGG + Intronic
1187073676 X:15913372-15913394 CAGGGCAAGCATGTGGATGGAGG - Intergenic
1187612505 X:20957699-20957721 TTGGGCAACTGAGAGGATGGTGG - Intergenic
1190277229 X:48906633-48906655 TTGGACAGCAGGGTGGATGGGGG - Intronic
1190947245 X:55108025-55108047 CTAGGCAACTAGGTGGATGTTGG - Intronic
1192373378 X:70534379-70534401 TTGGGCAACCAGAAGAATGATGG + Intronic
1193921671 X:87435602-87435624 TTGATCAACAGGGTGGATGGTGG - Intergenic
1195954070 X:110310286-110310308 CTGGGGAACCATGAGGATGGTGG - Intronic
1196811848 X:119635151-119635173 TTGGGCAACCAGGTGGATGGTGG + Intronic
1196830773 X:119773826-119773848 TTGAGCAACAGGGTGGATGGTGG + Intergenic
1198162619 X:134022583-134022605 TTGGGCAGCTGGGTTGATGGCGG - Intergenic
1198207755 X:134484022-134484044 TGGGGCAAACAGGAGTATGGAGG + Intronic
1198439240 X:136645875-136645897 TTGGGCAATTAAGTGGGTGGTGG + Intergenic
1198517089 X:137420535-137420557 TTGAGCAACCAGATGGATGGTGG - Intergenic
1198646415 X:138811808-138811830 TTGAACAACCTGGTGGATGGTGG - Intronic
1200086460 X:153609676-153609698 TGGGCCAACCAGGTGGGTGAAGG + Intergenic
1200351954 X:155506381-155506403 TTGGGAAACTTAGTGGATGGTGG + Intronic