ID: 1196811952

View in Genome Browser
Species Human (GRCh38)
Location X:119635949-119635971
Sequence CAGGATGGAGTGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3215
Summary {0: 1, 1: 0, 2: 15, 3: 275, 4: 2924}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196811952 Original CRISPR CAGGATGGAGTGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr