ID: 1196812893

View in Genome Browser
Species Human (GRCh38)
Location X:119642797-119642819
Sequence CTGGCGGCCAAGCAATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196812893 Original CRISPR CTGGCGGCCAAGCAATTTGA GGG (reversed) Intronic
906927938 1:50138911-50138933 GTGGCTGCAAAGCAATATGAAGG + Intronic
919360972 1:196594124-196594146 CTGGCTGTCAAGCAGATTGATGG + Intronic
921866751 1:220094431-220094453 CTGGCGGCCCAGCAGCTTCATGG - Exonic
1063039420 10:2321684-2321706 CTGGAAGCCAATCAATTTCATGG - Intergenic
1064767975 10:18694413-18694435 CTGGCTGCCATGCAGTTAGAAGG + Intergenic
1066312251 10:34208748-34208770 CTGGCTGCCTAGGAATCTGATGG - Intronic
1068091961 10:52442802-52442824 CTCACAGCCAAGCAGTTTGAGGG - Intergenic
1075514452 10:123097984-123098006 CTGGTGGCCATGAAATTTGGAGG - Intergenic
1077003026 11:334466-334488 CTGGTTGCCAGGCGATTTGAGGG - Intergenic
1081609592 11:44552731-44552753 CTGGAGCCCAAGCACTTTGCTGG - Intergenic
1083451211 11:62746651-62746673 TTGGCCGCCAAGCAATTAGCTGG + Intergenic
1084022670 11:66426960-66426982 CTGGACGCCAAGCACCTTGAGGG - Intergenic
1091821163 12:3476153-3476175 CTGGGAACCAAGCAATCTGAAGG + Intronic
1107598747 13:41991115-41991137 CTGGCTCCCAAGTAATTTGAGGG - Intergenic
1115354077 14:32428471-32428493 CTTGTGGCCAAACAATATGAAGG - Intronic
1117079207 14:52133922-52133944 CTGGAGTTAAAGCAATTTGAAGG + Intergenic
1118609946 14:67532542-67532564 CTGGCTGCCAGGCAGTTTGCAGG - Intronic
1127662976 15:61117916-61117938 CTTGAGCCCAAGCAATTTGAAGG - Intronic
1130562792 15:84971770-84971792 CTGGCGTCCCAGCTACTTGAGGG - Intergenic
1138334667 16:56243619-56243641 CTGGTTGCCAAGGAATTGGAGGG + Intronic
1138438467 16:57020298-57020320 CTGGAGGACAAGCAAATTGGGGG - Intronic
1138609617 16:58112255-58112277 CTGAGGGGAAAGCAATTTGAGGG - Intergenic
1143966889 17:10761945-10761967 CTGGCTGCCATGCTGTTTGAGGG + Intergenic
926387002 2:12345584-12345606 CTGTAGTCCTAGCAATTTGATGG - Intergenic
1172749044 20:37236762-37236784 CTGCCGGCCTAGCTCTTTGAAGG + Intronic
1175277996 20:57784915-57784937 CTGGCTGCCAAGCAAGAAGATGG + Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
949522990 3:4873674-4873696 CTGGGGGTGAAGTAATTTGAAGG + Intronic
952880917 3:37985923-37985945 CTGGTGGCCATGCCAGTTGATGG - Intergenic
954861575 3:53695072-53695094 CTGGCAGCCAAGTAGTTTGGTGG - Intronic
962286499 3:134090658-134090680 CTGGCTGCAAAGGAATCTGAGGG + Intronic
967597365 3:191342669-191342691 CTGGCTGCCAAACCATTTGAGGG + Intronic
978547001 4:109880570-109880592 CTGATGGCCAAGCAACATGATGG - Intergenic
988904662 5:35774000-35774022 CTTGCTGCCTTGCAATTTGAAGG + Exonic
1004496124 6:16164947-16164969 CTGGGGGCCAAGCACTGTGGTGG + Intergenic
1010379609 6:75209098-75209120 CTGTCGGACAAGAAATCTGAGGG - Intergenic
1016602542 6:145878814-145878836 CTGGCTGCCAAGAAAAATGATGG - Intronic
1016645525 6:146403311-146403333 CTGAGTGCCAAACAATTTGATGG + Intronic
1020680523 7:11231542-11231564 CTGCAGGCTAAGCAATTTTATGG - Intergenic
1022476526 7:30714467-30714489 CTGGGAGGCAAGCAATTTGAAGG - Intronic
1034450161 7:151132969-151132991 CTGGCGGGAAAGCAGTCTGATGG + Intronic
1035958619 8:4112128-4112150 CTGGATGCCCAGCACTTTGAAGG - Intronic
1038947791 8:32380400-32380422 CAGGTGGCCAAGCAACTGGAGGG - Intronic
1043940221 8:86188640-86188662 CTGGGGGGCAAGGACTTTGAGGG - Intergenic
1050412815 9:5383913-5383935 ATGGAGGAGAAGCAATTTGAAGG + Intronic
1051533070 9:18127016-18127038 CTGGCTGCCCAGCATCTTGACGG - Intergenic
1051726717 9:20095326-20095348 CTGTGGGCCAATCAAGTTGACGG - Intergenic
1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG + Intergenic
1053901476 9:42799931-42799953 GTGGCGGTTCAGCAATTTGATGG + Intergenic
1054533489 9:66205620-66205642 GTGGCGGTTCAGCAATTTGATGG - Intergenic
1055730478 9:79275383-79275405 CTGGCTGCCATGCCAGTTGAAGG - Intergenic
1190141053 X:47845020-47845042 TTGGTGGCCAAGTTATTTGAAGG + Intronic
1193833514 X:86315760-86315782 CTCACGGCCAAGGAAATTGAGGG + Intronic
1196812893 X:119642797-119642819 CTGGCGGCCAAGCAATTTGAGGG - Intronic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic