ID: 1196815645

View in Genome Browser
Species Human (GRCh38)
Location X:119663512-119663534
Sequence CTCACGATCGTTAGCACAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196815645_1196815651 29 Left 1196815645 X:119663512-119663534 CCAACTGTGCTAACGATCGTGAG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1196815651 X:119663564-119663586 CATAGGTATTAGACTGGAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 93
1196815645_1196815650 23 Left 1196815645 X:119663512-119663534 CCAACTGTGCTAACGATCGTGAG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1196815650 X:119663558-119663580 GGAGGTCATAGGTATTAGACTGG 0: 1
1: 0
2: 0
3: 3
4: 73
1196815645_1196815647 5 Left 1196815645 X:119663512-119663534 CCAACTGTGCTAACGATCGTGAG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1196815647 X:119663540-119663562 GCCTCACGTTGCTCTCTTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 78
1196815645_1196815646 2 Left 1196815645 X:119663512-119663534 CCAACTGTGCTAACGATCGTGAG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1196815646 X:119663537-119663559 TTAGCCTCACGTTGCTCTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 85
1196815645_1196815649 12 Left 1196815645 X:119663512-119663534 CCAACTGTGCTAACGATCGTGAG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1196815649 X:119663547-119663569 GTTGCTCTCTTGGAGGTCATAGG 0: 1
1: 1
2: 1
3: 16
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196815645 Original CRISPR CTCACGATCGTTAGCACAGT TGG (reversed) Exonic
1089685886 11:120146689-120146711 CTCAATTTCGTTAGCACACTTGG - Intronic
1100707171 12:97213360-97213382 CTCAATATCGTTAGAACACTGGG + Intergenic
1103562878 12:121801189-121801211 CTCACGATCGAAAGGAAAGTGGG + Intronic
1112822870 13:103356377-103356399 CTCTCCATCATTACCACAGTGGG - Intergenic
1114932914 14:27496506-27496528 CTCATAATCTTTTGCACAGTAGG + Intergenic
1125478031 15:40060806-40060828 CTCAGCAGCGTTTGCACAGTAGG - Intergenic
1129248028 15:74291850-74291872 CTCACTGTTGTTAGCAGAGTTGG - Intronic
1138918608 16:61499379-61499401 CTCAGGATGGTTTACACAGTGGG - Intergenic
1139193749 16:64894982-64895004 CTCACTATCATGAGAACAGTGGG + Intergenic
1151678228 17:75610714-75610736 CTCACCAGCCTTAGCACTGTGGG - Intergenic
1154503750 18:15011672-15011694 CTCATAATCTTTTGCACAGTAGG + Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1164787981 19:30951886-30951908 CTAACGTTTGATAGCACAGTAGG - Intergenic
1166848658 19:45746544-45746566 CTCAAGATCCTTAACACAGCGGG + Intronic
926811843 2:16762036-16762058 CGAACGATAGATAGCACAGTAGG + Intergenic
927115652 2:19899140-19899162 CTCTCCATCGTTAGCAAACTTGG - Intronic
938502932 2:131841828-131841850 CTCATAATCTTTTGCACAGTAGG + Intergenic
940154026 2:150634151-150634173 CTCACAATGGTTAGCATAGTGGG - Intergenic
940459270 2:153941606-153941628 CTAACCAACGTAAGCACAGTTGG - Intronic
1172041617 20:32050681-32050703 CTCAAAATAGTTAGCACTGTAGG + Intergenic
1176975111 21:15312180-15312202 CTCACTATCGTGAGAACAGCAGG - Intergenic
957314674 3:78562039-78562061 CTCACTATCATGAGAACAGTAGG + Intergenic
966590877 3:181681539-181681561 TTCACGTTTGATAGCACAGTAGG - Intergenic
980251177 4:130317436-130317458 ATCACGACCATTAGCACACTTGG + Intergenic
992583187 5:78203417-78203439 CTCACTATCATGAGAACAGTAGG + Intronic
995062278 5:107823672-107823694 CTCACTATCATTAGAACAGAAGG - Intergenic
1012000466 6:93647744-93647766 CTCTAGATCTTTAACACAGTTGG - Intergenic
1034782928 7:153898098-153898120 CTCATGTTCAATAGCACAGTAGG + Intronic
1037434741 8:18850783-18850805 CTCACCATCAATAGCAGAGTTGG + Intronic
1039170139 8:34735366-34735388 CTGATGTTCGATAGCACAGTAGG + Intergenic
1046077057 8:109325265-109325287 CTCATGTTTGATAGCACAGTTGG + Intronic
1046188945 8:110764085-110764107 CTAGTGTTCGTTAGCACAGTAGG - Intergenic
1052527912 9:29644338-29644360 CTTACGATCGATAGCAAAGGAGG - Intergenic
1055185821 9:73452726-73452748 CTCTCTATCGTGAGAACAGTAGG - Intergenic
1059815967 9:117915489-117915511 CTGATGATTGATAGCACAGTAGG + Intergenic
1186932411 X:14409182-14409204 CTAATGTTCGGTAGCACAGTAGG - Intergenic
1196815645 X:119663512-119663534 CTCACGATCGTTAGCACAGTTGG - Exonic