ID: 1196815819

View in Genome Browser
Species Human (GRCh38)
Location X:119664947-119664969
Sequence GCCCCAGATGTGCCTCCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 218}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196815804_1196815819 21 Left 1196815804 X:119664903-119664925 CCCCACCTCTCCTCCCTGCCAGG 0: 1
1: 0
2: 10
3: 104
4: 923
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815813_1196815819 3 Left 1196815813 X:119664921-119664943 CCAGGCCTAAACAGCCCTCTGGG 0: 1
1: 0
2: 0
3: 15
4: 181
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815816_1196815819 -2 Left 1196815816 X:119664926-119664948 CCTAAACAGCCCTCTGGGGATGC 0: 1
1: 0
2: 2
3: 16
4: 124
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815802_1196815819 27 Left 1196815802 X:119664897-119664919 CCCAGTCCCCACCTCTCCTCCCT 0: 1
1: 2
2: 12
3: 139
4: 1175
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815810_1196815819 8 Left 1196815810 X:119664916-119664938 CCCTGCCAGGCCTAAACAGCCCT 0: 1
1: 0
2: 1
3: 45
4: 321
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815811_1196815819 7 Left 1196815811 X:119664917-119664939 CCTGCCAGGCCTAAACAGCCCTC 0: 1
1: 0
2: 0
3: 16
4: 295
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815803_1196815819 26 Left 1196815803 X:119664898-119664920 CCAGTCCCCACCTCTCCTCCCTG 0: 1
1: 0
2: 12
3: 170
4: 1572
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815806_1196815819 20 Left 1196815806 X:119664904-119664926 CCCACCTCTCCTCCCTGCCAGGC 0: 1
1: 0
2: 6
3: 94
4: 870
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815809_1196815819 11 Left 1196815809 X:119664913-119664935 CCTCCCTGCCAGGCCTAAACAGC 0: 1
1: 0
2: 4
3: 74
4: 805
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815807_1196815819 19 Left 1196815807 X:119664905-119664927 CCACCTCTCCTCCCTGCCAGGCC 0: 1
1: 0
2: 10
3: 167
4: 1229
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218
1196815808_1196815819 16 Left 1196815808 X:119664908-119664930 CCTCTCCTCCCTGCCAGGCCTAA 0: 1
1: 0
2: 6
3: 50
4: 515
Right 1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG 0: 1
1: 0
2: 0
3: 26
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196815819 Original CRISPR GCCCCAGATGTGCCTCCCCA CGG Intronic
900192446 1:1357140-1357162 GCCCCTGAGGTGCTTCCGCAGGG + Intronic
900799883 1:4730712-4730734 GGCCCAGATGTGGCTCAACATGG - Intronic
901152377 1:7112515-7112537 GCCCCAGATCTGACTCCAGATGG + Intronic
901646211 1:10718108-10718130 GCCCCAGCTGGGCCTGCCCCTGG - Intronic
901664244 1:10817379-10817401 GCCCCTGCTGTGGCTTCCCAGGG + Intergenic
903677367 1:25072775-25072797 GCCCCAGCTCTGCCTCTCCAAGG - Intergenic
904112238 1:28135221-28135243 TCCCCAAATTTGCTTCCCCAGGG + Intergenic
904328698 1:29744300-29744322 GCACCTGATGTCCCTCCCAAGGG + Intergenic
904678124 1:32211162-32211184 TCACCAGATATCCCTCCCCATGG - Intronic
906479104 1:46188813-46188835 GCCCCAGCTGGGCCTGTCCATGG + Exonic
906637189 1:47417215-47417237 GCCTCAGGTAGGCCTCCCCAGGG - Exonic
907405484 1:54251265-54251287 ACCCCAGAGCTGCCTCCCCTGGG - Intronic
907714690 1:56916068-56916090 TACCCAGACGTGCCTCTCCATGG + Intronic
908535759 1:65075521-65075543 GCCTCTGATGTGCCTCCCTTTGG + Intergenic
909145082 1:71919957-71919979 GCTCCAGCTGTGGCTCTCCAGGG + Intronic
910112027 1:83693083-83693105 GCCCCAGCTGTGCCTGCTCTGGG + Intergenic
910348320 1:86266559-86266581 GAAGCAGATGTGCCTCTCCAGGG - Intergenic
912470411 1:109902802-109902824 GCACCAGATGTGCCTCTTCACGG + Intergenic
918641940 1:186852118-186852140 GGCCCACATGTGCCTACACAGGG + Intronic
920164488 1:204026063-204026085 GCTCCAGATCTCTCTCCCCATGG - Intergenic
922994404 1:229944451-229944473 GCGCCAAATGTGCAGCCCCAGGG + Intergenic
923547294 1:234932089-234932111 GCCCAAGCTCTGCTTCCCCATGG + Intergenic
1063577521 10:7275128-7275150 GCCCCAGGTCTGCCTCCCTGCGG - Intronic
1065981529 10:30902868-30902890 GCACCACCTGAGCCTCCCCAAGG - Intronic
1067035083 10:42909194-42909216 TGCCCAGATTTGCCTCCCCAAGG - Intergenic
1067462204 10:46466061-46466083 GCTCAAGATGCGGCTCCCCAGGG - Intergenic
1067540085 10:47144722-47144744 GCCTCAGCTGGGCCTCGCCAGGG - Intergenic
1067624992 10:47918537-47918559 GCTCAAGATGCGGCTCCCCAGGG + Intergenic
1069574360 10:69516410-69516432 GCCCCAGCAGTGCCTCCACCTGG + Intergenic
1069833871 10:71296636-71296658 GGCCAAGCTGTGCCTCTCCAGGG - Exonic
1071474872 10:86017550-86017572 GACCCAGTTGTGCCTGCTCAAGG - Intronic
1071492874 10:86147958-86147980 GCCTCACCTGTTCCTCCCCATGG + Intronic
1071597779 10:86940677-86940699 GCCCCAGCTGACCCTCCCTATGG - Intronic
1072234112 10:93438526-93438548 TCCCCAGACGTCCCTCACCAGGG + Intronic
1072670129 10:97423354-97423376 GCCCCAGAGGCGTCACCCCATGG - Intronic
1074145800 10:110716244-110716266 GCCCCAGATGTCTCCCTCCAGGG + Intronic
1075622752 10:123939810-123939832 ACCCCAGATGTGCCTGATCAGGG + Intronic
1075874718 10:125796609-125796631 ACTCCAGCTGTGCCTCCACATGG + Intronic
1076047048 10:127302371-127302393 GCCCCAGGAGTGGCCCCCCAGGG - Intronic
1076268994 10:129134093-129134115 CCCCCAAATGTGCCTGCCCATGG + Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077431971 11:2520237-2520259 GGACCAGACGTGCCTCACCAGGG + Intronic
1077466928 11:2737913-2737935 CCCCCAGGTGTGCCTCCCCTGGG - Intronic
1077475513 11:2788502-2788524 GCCCCAGACCTGCCTCTCCTCGG + Intronic
1077488584 11:2850226-2850248 GGCCCAGATGGGCGGCCCCACGG - Intergenic
1078175259 11:8964976-8964998 GCTCCCCATGTGCCTCCCCTTGG + Intronic
1079834815 11:25321586-25321608 TCCCCAAATGTGCCTGCTCATGG + Intergenic
1083273490 11:61583979-61584001 GGCCCAGAGGTGTCTGCCCAGGG - Intergenic
1083487605 11:62993367-62993389 GGCCCAGACCTGCTTCCCCAGGG + Intronic
1083820741 11:65170075-65170097 CACCCAGCTGTGGCTCCCCAGGG - Intergenic
1084170586 11:67399091-67399113 CCCACAGATGTGCCTGACCAGGG - Exonic
1084474003 11:69378476-69378498 GTCCAGGCTGTGCCTCCCCATGG - Intergenic
1084857402 11:71997905-71997927 TCCCCAGCTGTGGCTTCCCATGG + Intergenic
1088131417 11:106496524-106496546 GCCACAGATTTGCTTCCTCAAGG + Intergenic
1091295318 11:134470128-134470150 GTCCCAGATGTGGCTTCTCATGG + Intergenic
1091973778 12:4809568-4809590 GCGCCAGATGCGCCTCCCTCCGG - Exonic
1096246517 12:49991970-49991992 GCCCAAGATGTGCTTCTTCAGGG - Intronic
1097161557 12:57049825-57049847 GCCCCAGATGGGGCGCCCCAAGG + Intronic
1097351778 12:58556766-58556788 GCCTCAGCAGTGCCTCCCCAAGG + Intronic
1102933017 12:116876775-116876797 GCCTCAGAGGAGCCTCCCCTGGG + Intronic
1103341323 12:120222657-120222679 GGCCCAGCTTTGCCTCCCAAGGG + Exonic
1104033127 12:125079369-125079391 GCTCCAGCTCTGCGTCCCCAGGG + Intronic
1104658707 12:130593166-130593188 GGCCCCGGTGTGGCTCCCCAAGG + Intronic
1104971894 12:132534537-132534559 GCCCCACATGTGCCCACACAGGG + Intronic
1108567841 13:51718928-51718950 GCCCCACTTGTGCCAACCCAAGG - Intronic
1113778789 13:112963923-112963945 GCCCCAGAGATTCCACCCCAAGG + Intronic
1113921471 13:113915535-113915557 GCCCCAGCTGTGCCTCAGCGAGG + Intergenic
1119181916 14:72611089-72611111 GCCCCAGAGGAGCCTTCCCTTGG + Intergenic
1119699291 14:76742173-76742195 TCCCCAGGTGGGCCTCTCCATGG + Intergenic
1120100634 14:80441250-80441272 GCCCCAGATGTGGCTGGGCATGG + Intergenic
1120140332 14:80923617-80923639 GCCTCAGCTGTCCCTGCCCAAGG + Intronic
1120563210 14:86022286-86022308 GCCCCAGAGGTGCCTAGCTAAGG - Intergenic
1121315981 14:92961253-92961275 GCCCCAGGTGTGGCTCCTGAGGG + Intronic
1122507636 14:102241870-102241892 CCTCCAGAACTGCCTCCCCAAGG + Intronic
1122775177 14:104113839-104113861 GCCCCTCATGGGCCTCACCAGGG - Exonic
1123008912 14:105337905-105337927 CCCCCACATGTGCACCCCCAGGG + Intronic
1124129895 15:26974183-26974205 GGCCCTGATATGCCTCCCAAAGG + Intronic
1124955326 15:34356451-34356473 GCCGCAACTGTGCCTCCACAGGG - Exonic
1125590875 15:40853887-40853909 GCCCCAGAGCTGCCTCTCAAAGG - Exonic
1126386693 15:48100689-48100711 CCCCCAGAGGTGCCCTCCCAGGG + Intergenic
1127582894 15:60353817-60353839 GCTCCACATATGCCTCTCCATGG - Intronic
1128347868 15:66865995-66866017 GGCCCCAATGTTCCTCCCCAAGG + Intergenic
1128603735 15:69018765-69018787 GCCCGGGATGTGGCTCCCCAGGG - Intronic
1129228105 15:74181492-74181514 TCCCCAGAGCTCCCTCCCCAGGG + Intronic
1129987503 15:79931348-79931370 CCTCCAGATGTGCCTCCCTCTGG + Intergenic
1130213627 15:81948534-81948556 GCCCTAGCTGTGCCTTCCCTGGG - Intergenic
1130639284 15:85655721-85655743 CCCCCAGCTGTGCCTCCGGAAGG - Exonic
1130808563 15:87352908-87352930 CTCCCAGAAGTCCCTCCCCATGG + Intergenic
1130980627 15:88809753-88809775 GCCCCACAGGGGCATCCCCATGG + Intronic
1132204246 15:99975667-99975689 GCCCCATGTGTGCATCCTCATGG + Intronic
1133230823 16:4365733-4365755 ACCCCAGCTGCTCCTCCCCAGGG + Intronic
1135849456 16:25949946-25949968 GACCCTGATGACCCTCCCCAAGG - Intronic
1136286815 16:29248998-29249020 GCCCCAGTCATGCATCCCCAGGG + Intergenic
1136517764 16:30778112-30778134 GGCCCAGCTGTGCAGCCCCAGGG - Intergenic
1136576149 16:31126577-31126599 GCCCCAGAGGTCCCTCCCACAGG - Intronic
1137603297 16:49770885-49770907 ACCCCACAGGAGCCTCCCCACGG + Intronic
1137802664 16:51275503-51275525 GCCCCTCATCTGCTTCCCCATGG - Intergenic
1137810586 16:51349263-51349285 GCCCCAGAGTTTCATCCCCAGGG - Intergenic
1139529966 16:67538025-67538047 GCCCCCGATTTCCCCCCCCAGGG - Intronic
1139613920 16:68077736-68077758 GCCCCAGATGTGGTGCCCCTGGG + Intronic
1140783502 16:78317709-78317731 TCAGCAGGTGTGCCTCCCCATGG + Intronic
1141457299 16:84151841-84151863 TCACCACATGAGCCTCCCCATGG + Intronic
1141661593 16:85444513-85444535 GCCCCAGAAGCCCCTCCCCAGGG - Intergenic
1142226582 16:88880649-88880671 GCCCCAGATGCGCCTCTCACCGG - Intronic
1142491209 17:280998-281020 GTCCCAGCCCTGCCTCCCCAGGG + Intronic
1143865059 17:9917467-9917489 CCCTCAGATGGGCCTCCCCCTGG - Intronic
1144128626 17:12224793-12224815 GCCCCAGACGTCACTCCCTATGG - Intergenic
1144586009 17:16488193-16488215 TCCCCAGATGTCCTTCCCCTTGG - Intronic
1144954086 17:19010438-19010460 CCCCCAGCTCTGCCTCCCCGGGG + Intronic
1147912853 17:43866908-43866930 GGCCCAGATGTTCCACTCCAAGG - Intergenic
1150435469 17:65150851-65150873 GCCCCAGATGTGCTTGCCAATGG - Intronic
1150653854 17:67027006-67027028 GCCCCAGAGCGTCCTCCCCACGG + Intronic
1151329105 17:73396399-73396421 CCCCCAGTTCTGCTTCCCCAGGG + Intronic
1151599890 17:75099802-75099824 ACCCCAGATCTGCCCTCCCAAGG - Intronic
1151975424 17:77481376-77481398 GCACCACATCTGCCTCCCCCTGG - Intronic
1152331812 17:79677837-79677859 GCCCCAGCTCTGCCAACCCACGG - Intergenic
1152390584 17:80001667-80001689 GACCCAGTTGTCCCTCCCCTGGG + Intronic
1152589907 17:81206491-81206513 GCCCCATGTGAGCCTCCCCAAGG + Intronic
1156341315 18:36212721-36212743 ACCCCACATGTGACTTCCCAGGG + Intronic
1157424174 18:47570811-47570833 CCCAGATATGTGCCTCCCCAGGG - Intergenic
1157616943 18:48992588-48992610 GCCCCAAATGTGGGTCCCCTGGG + Intergenic
1159958241 18:74534799-74534821 GCCCCAGATGCTGCTCCTCATGG + Intronic
1161154157 19:2723520-2723542 GCCCCAGCTCTGCCTCTCCATGG + Intronic
1161513079 19:4682589-4682611 GCCCCAGCTGGCCCTGCCCAGGG - Intronic
1161530358 19:4785331-4785353 GCCCGAGATGTGCCTGCGCATGG + Intergenic
1161578201 19:5066385-5066407 GCCTCACATGTGTCTCCCCATGG + Intronic
1161578210 19:5066428-5066450 GCCTCACATGTGTCTCCCCATGG + Intronic
1161682413 19:5686856-5686878 GCCCCGGAGGCCCCTCCCCAAGG - Intronic
1161967658 19:7557217-7557239 GCCCCCGCTGTGCGACCCCAAGG + Exonic
1162883769 19:13680964-13680986 CCCCCAAATCTGTCTCCCCAAGG + Intergenic
1166719689 19:44989957-44989979 GCCACAGATCTTCCTTCCCAGGG + Intronic
1168310867 19:55459869-55459891 CCCCCAGATCTGCCCCTCCATGG - Intronic
1202649236 1_KI270706v1_random:165814-165836 CCCCCAGCTGGGACTCCCCAAGG + Intergenic
925285672 2:2714195-2714217 CCACCAGGTGGGCCTCCCCAAGG - Intergenic
925618641 2:5768713-5768735 TCCCCTGTTGTACCTCCCCAAGG - Intergenic
926146158 2:10398181-10398203 TCCCCAAATGTCCCTCCCCCAGG - Intronic
926271224 2:11368028-11368050 GCCCCACATCTGCCTTCTCAGGG + Intergenic
928366393 2:30706470-30706492 TCTGCACATGTGCCTCCCCAGGG + Intergenic
928606328 2:32947536-32947558 CCCCCAGCCGTGCCTCCCCCGGG + Exonic
931434015 2:62231689-62231711 GCCCCAGAGGCCCCTTCCCAAGG - Intergenic
933900918 2:86849473-86849495 TCTGCAGATTTGCCTCCCCAGGG - Intronic
935779624 2:106499758-106499780 TCTGCAGATTTGCCTCCCCAGGG + Intergenic
935856411 2:107279295-107279317 GACACAGATGTGCCTCATCATGG + Intergenic
937297545 2:120818650-120818672 GCCCCAGGCGTGTCTCTCCAGGG + Intronic
938076180 2:128339810-128339832 TCCACAGAGGTGCCTGCCCAGGG + Intergenic
938206430 2:129428348-129428370 GCCCCAGCAGTGCCTGCACAGGG + Intergenic
938370866 2:130767639-130767661 GGCTCAGATGTGGCTCCACAGGG - Exonic
938540421 2:132280259-132280281 GCCCCAGTTGTGGCCACCCATGG - Intergenic
938603164 2:132864074-132864096 GACCCAGAACAGCCTCCCCAAGG + Intronic
940633198 2:156264244-156264266 TGCCCAGATTTGCCTCCCCAAGG + Intergenic
941001262 2:160205725-160205747 GCCCCAGCTGGGCCTGCCCCGGG + Intronic
946076521 2:217078048-217078070 GTCCCAGATGGGCCATCCCAAGG - Intergenic
947707239 2:232286138-232286160 TCAACAGATGTGCCTCCACAAGG - Intronic
1170830179 20:19833038-19833060 GCCCTACATGTTCCTCCCCACGG + Intergenic
1170937520 20:20823028-20823050 GCCCCAGCTGTGCCTTCAGAAGG + Intergenic
1171869346 20:30513264-30513286 GCCCCAGTTGTGGCCGCCCATGG - Intergenic
1172172370 20:32946045-32946067 GCTCCAAATCTGCCTCCTCAAGG + Intronic
1174203476 20:48823335-48823357 GCCCCTGAGGTGCCTCCCCTTGG + Intronic
1174656418 20:52175971-52175993 GGCCCAAATGTCCCTCCCCAGGG + Intronic
1175633475 20:60561124-60561146 GCCCCTGATGTCCCTCTGCAGGG + Intergenic
1175688118 20:61046073-61046095 TCCCCAGGTGTGTCTCCACAGGG + Intergenic
1175688135 20:61046148-61046170 TCCCCAGGTGTGTCTCCACAGGG + Intergenic
1176160347 20:63644362-63644384 GCCCCCGTTTTCCCTCCCCATGG + Intronic
1177736104 21:25092497-25092519 GCCCCAGGTGCACCTCCTCACGG + Intergenic
1178321856 21:31611891-31611913 GCCCTGGCTGTGCCTCCCTATGG + Intergenic
1178935035 21:36854358-36854380 GCCCCAGATGTGCCTGTCTCTGG - Intronic
1179406797 21:41132808-41132830 GCCCCTGATTTTCTTCCCCAGGG - Intergenic
1182518331 22:30871460-30871482 GGCCCAGATGTGCCGCCCTGGGG - Intronic
1183165206 22:36142504-36142526 GCCCCAGAGATCCCTTCCCAGGG - Intronic
1183866825 22:40710826-40710848 GCCCCACACTTGGCTCCCCACGG + Intergenic
1184530105 22:45049911-45049933 GAACCAGATCTGCCTGCCCATGG - Intergenic
950206544 3:11085199-11085221 GCTCAAGATGAGCCTCCACAGGG + Intergenic
950675841 3:14554000-14554022 GCCCCAGATGTGACTGCCCTGGG + Intergenic
953849594 3:46455609-46455631 GACTCAGCTGTGCCTCCCAAGGG + Intronic
953899776 3:46833573-46833595 GCCGCAGATGTGCCTGCCTTTGG + Exonic
953979198 3:47405257-47405279 GCCCCAGCAGAGGCTCCCCACGG - Intronic
954337509 3:49928411-49928433 GCCCCAGATGCCCCTTCTCAGGG + Intronic
954663575 3:52238834-52238856 CCCCCAGATGTGCCCACCCCAGG + Intronic
955405723 3:58624571-58624593 GCCACAGATCTGTCTCCCAATGG - Intronic
956548992 3:70438329-70438351 CCCCCAGAACTGCCTCCCCCAGG - Intergenic
958936127 3:100257790-100257812 TCCCCAAATGAGCCTCTCCATGG - Intergenic
960679155 3:120228856-120228878 GCACCAGATGTGCTTCCCTTTGG + Intronic
961160380 3:124719082-124719104 GCTCCAGATGTCTGTCCCCAGGG - Intronic
962809643 3:138949587-138949609 CCCCAAGATGTGCCTTCACATGG + Exonic
962977070 3:140455273-140455295 CCACCAGTTGTGCCTCCTCAGGG - Intronic
965300615 3:167001339-167001361 GTCCCAGATGGGCCTTGCCAAGG + Intergenic
966946252 3:184779095-184779117 ACCCCAGGTCTGCCTCTCCAGGG - Intergenic
968007050 3:195250166-195250188 TGCCCAGATGCTCCTCCCCAGGG + Intronic
968699290 4:2047121-2047143 GCCCCTGTTCTTCCTCCCCACGG + Intergenic
968760909 4:2442463-2442485 GTCACTGCTGTGCCTCCCCAGGG - Intronic
969029139 4:4197359-4197381 GCCAGAGATGTGGCTCCCCAGGG - Exonic
969689416 4:8696073-8696095 TCCCCAGATCTGCTTCCCCAGGG + Intergenic
970369410 4:15392551-15392573 GCCCCAGCTCAGCCTCTCCAGGG + Intronic
983692013 4:170482054-170482076 GCCCCAGCTGTGCTTCCCTGGGG - Intergenic
985624230 5:976855-976877 GCCCCAGAGGTCCCTCAGCAGGG + Intergenic
986223648 5:5793154-5793176 GCCCCAGATGTTCCACAGCAAGG + Intergenic
987098875 5:14574956-14574978 GGTCCAGAATTGCCTCCCCAAGG + Intergenic
988589860 5:32539361-32539383 GCACCAGAGGTGCCCCACCAGGG + Intronic
989396495 5:40962778-40962800 GCCCCAGTGGTGCCTCTTCATGG + Intronic
991692078 5:69235026-69235048 GCCTCACCTGTCCCTCCCCAAGG - Exonic
992401076 5:76411961-76411983 GCCCCCCATGTGCCACCCCCAGG - Intronic
997982216 5:138475428-138475450 AGCCCAGATGTCCCTCCACAGGG - Intergenic
998383871 5:141744786-141744808 TCCCCAGAAGTGTCTCCCCATGG - Intergenic
998410880 5:141910309-141910331 CTCCTAGAGGTGCCTCCCCAAGG - Intergenic
999127718 5:149258803-149258825 GCCCCAGAGGGGCCCTCCCATGG + Exonic
1001088003 5:168715480-168715502 GCCCCAGAAGTGTCTCTCCTTGG - Intronic
1001682690 5:173570481-173570503 GGCCGAGATGACCCTCCCCACGG - Intergenic
1002072007 5:176684537-176684559 GCCCCGTATGTACCACCCCATGG - Intergenic
1003903857 6:10680645-10680667 CTCCCAGCTCTGCCTCCCCAAGG - Intronic
1006625854 6:35397297-35397319 GCACCAGTGCTGCCTCCCCATGG + Intronic
1011855956 6:91691684-91691706 GCCGCAGATGTGCTTACCTAAGG - Intergenic
1022524542 7:31028711-31028733 GTCCCAGAGGTGCCTCTCCCAGG - Intergenic
1023721593 7:43100661-43100683 GCCTCACATGTGCCTCTACAAGG - Intergenic
1023861439 7:44219717-44219739 GCCCCAGATGGGCGTTCCCCAGG - Intronic
1024258765 7:47558724-47558746 GTCCCAGCTCTGCCTCCCCAGGG + Intronic
1024819513 7:53310953-53310975 GCACCAGATATGCCTCCTCTGGG + Intergenic
1025613268 7:63096496-63096518 GCCCCAGATGCCCCCTCCCAAGG - Intergenic
1026977366 7:74506819-74506841 CCCCCAGTTGTGGGTCCCCATGG - Intronic
1029284381 7:99455909-99455931 TCCCCAGCAGTGGCTCCCCAAGG + Intronic
1029660224 7:101955572-101955594 GCCCCAGCTGTGCGTTCCCTGGG - Intronic
1035345255 7:158193160-158193182 GCACCACATGTGTCTGCCCACGG - Intronic
1035870612 8:3133158-3133180 GCCCCAGGTCGGCCTCCCCCAGG - Intronic
1037581247 8:20247144-20247166 GGCCCAGATGTGTCCCCCCCAGG - Exonic
1037787083 8:21909602-21909624 GCCCCTGAAGTTCTTCCCCAAGG + Exonic
1037861727 8:22410149-22410171 GGCTCAGCTGTGCCGCCCCAGGG - Intronic
1037891379 8:22625561-22625583 CTCCCAGATGTGCCTCTCAAAGG + Intronic
1039391886 8:37187825-37187847 GGACCAGCTGTGTCTCCCCAAGG + Intergenic
1039984967 8:42439379-42439401 GGCCCAGCTGGTCCTCCCCAGGG + Intronic
1042334900 8:67619857-67619879 ACCTCAAATCTGCCTCCCCAAGG - Intronic
1043334048 8:79151264-79151286 GCCCCAGTAGAGCCTCTCCATGG - Intergenic
1044858061 8:96495220-96495242 GCCCCAGAAGCGCCCCGCCAGGG - Intronic
1048812978 8:138304968-138304990 GCCACAGAAGAGCCTACCCAGGG - Intronic
1048889653 8:138936137-138936159 GTCCCAGATGAGCCTCTCCTGGG - Intergenic
1049513637 8:143042493-143042515 GCCCCAGGAGCACCTCCCCAAGG + Intronic
1051586918 9:18736381-18736403 GCCTGGGATGTGCCTTCCCAAGG - Intronic
1051663289 9:19445153-19445175 CCCCCAGGTGTTCGTCCCCAGGG + Intronic
1056690843 9:88807550-88807572 GCCCCAACCGTGCCTCCCCAGGG - Intergenic
1057034210 9:91799893-91799915 GCCCCAGGTGTGCGTGGCCAGGG + Intronic
1057469331 9:95343638-95343660 GCTCAAAATGTCCCTCCCCAAGG - Intergenic
1060063991 9:120486566-120486588 ACCCCAGAAGTGCCTGCCCATGG + Intronic
1062094931 9:134698244-134698266 GCCCCAGGTGGGCCTGGCCAAGG - Intronic
1189651593 X:43195660-43195682 TTGCCACATGTGCCTCCCCATGG - Intergenic
1196738331 X:119000565-119000587 GCCCCAGAGGTGGCCCCCAATGG - Intronic
1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG + Intronic
1197729437 X:129797411-129797433 ACCCCTGAGCTGCCTCCCCAGGG - Intergenic