ID: 1196818736

View in Genome Browser
Species Human (GRCh38)
Location X:119686171-119686193
Sequence CAGGCTCCCCAGAGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196818736_1196818743 13 Left 1196818736 X:119686171-119686193 CCAACTGCCCTCTGGGGAGCCTG 0: 1
1: 0
2: 5
3: 34
4: 336
Right 1196818743 X:119686207-119686229 CTCCATCTGGTCTTGTTTAATGG 0: 1
1: 0
2: 1
3: 9
4: 118
1196818736_1196818744 14 Left 1196818736 X:119686171-119686193 CCAACTGCCCTCTGGGGAGCCTG 0: 1
1: 0
2: 5
3: 34
4: 336
Right 1196818744 X:119686208-119686230 TCCATCTGGTCTTGTTTAATGGG 0: 1
1: 0
2: 0
3: 10
4: 135
1196818736_1196818740 0 Left 1196818736 X:119686171-119686193 CCAACTGCCCTCTGGGGAGCCTG 0: 1
1: 0
2: 5
3: 34
4: 336
Right 1196818740 X:119686194-119686216 AATTTGCCTCTGCCTCCATCTGG 0: 1
1: 0
2: 4
3: 74
4: 1978
1196818736_1196818746 15 Left 1196818736 X:119686171-119686193 CCAACTGCCCTCTGGGGAGCCTG 0: 1
1: 0
2: 5
3: 34
4: 336
Right 1196818746 X:119686209-119686231 CCATCTGGTCTTGTTTAATGGGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196818736 Original CRISPR CAGGCTCCCCAGAGGGCAGT TGG (reversed) Intronic
900086366 1:899770-899792 CAGGCTCCCTGGGGGACAGTGGG - Intergenic
900099799 1:956956-956978 CAGAGTCCCCAGAGGGCTGAAGG - Exonic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
901219970 1:7578227-7578249 CAGGATCCACAGAGGGCACCTGG - Intronic
901224621 1:7605989-7606011 CAAGCTCCCCCGAGGGCAGGAGG - Intronic
901790826 1:11653126-11653148 CTAGCTCCCCAGAGAGCTGTGGG - Intronic
902627461 1:17684838-17684860 CAGGCTCCCCAGAGGAGGGGAGG - Intronic
902661215 1:17905348-17905370 CAGGCTTCACAGAGGTCTGTTGG - Intergenic
903044608 1:20555264-20555286 CAGGCTCCCTGGAGGGACGTCGG + Intergenic
903180562 1:21602970-21602992 CAGGATCCCCAGAGGGGATGTGG - Intronic
904206966 1:28861770-28861792 CAGGCTCCCTAGAGGGAAGCAGG - Intronic
904480816 1:30792205-30792227 CAAGCTCCTCACAGGGCTGTGGG + Intergenic
904592025 1:31620219-31620241 CCTGCACCCCAGAGGGCAGGGGG + Intronic
905037273 1:34926396-34926418 CAGACTCCCCAGACGGCAGGAGG + Intronic
905180180 1:36160817-36160839 CAGGCTTCCCAGAGGACCCTGGG - Intronic
905514999 1:38556146-38556168 CAGATTCCTCAGAGGGAAGTCGG + Intergenic
906035838 1:42749963-42749985 AAGGCTTCCCAGAGGGAAATGGG - Intronic
907312101 1:53544607-53544629 GAGGGTCCCCAGAGGTCAGTCGG - Intronic
907454428 1:54566057-54566079 CTGGCTCTCCAGAGGGAAGGGGG - Intronic
907627297 1:56042697-56042719 CCTGCTCACCAGTGGGCAGTGGG + Intergenic
909233331 1:73119509-73119531 CAGGCTCCCCAAAGGGCCTATGG + Intergenic
910341605 1:86194613-86194635 CAGGCTCCACAAAGGACTGTTGG - Intergenic
912697479 1:111852327-111852349 CAGGCCCCACAGAGGGCTGAGGG - Intronic
912942025 1:114053658-114053680 CATGCTTCCAAGGGGGCAGTAGG - Intergenic
916214177 1:162381994-162382016 CAGGCTCACCAGAGCCCAGAGGG - Exonic
919552398 1:199007531-199007553 CAGGCTCCCAAGAGTGAGGTTGG - Intergenic
919612712 1:199765398-199765420 AAGACTCCTCAGAGGGCAATTGG + Intergenic
919833362 1:201557223-201557245 CAGGCACCTCAGAGGGCATTGGG - Intergenic
920097454 1:203495903-203495925 CAGGCTCTCCAGAGTGTTGTGGG - Intronic
920336910 1:205251003-205251025 CTGGCACCCCAGAGGGGACTGGG - Intronic
922744293 1:228035647-228035669 CAGGCTCTCCAGGGGCAAGTGGG + Intronic
922800421 1:228362416-228362438 CAGCCTCCTGAGAGGGGAGTGGG + Intronic
922980108 1:229818530-229818552 CAGCCTTCCCAGAGGTCAGAAGG + Intergenic
923575043 1:235150878-235150900 TAGGCTCCCCAAAGGGGAGAAGG + Intronic
924784861 1:247185242-247185264 CAGGCTCCCCAGAGAGCCCCTGG - Intergenic
1062904245 10:1169361-1169383 CAGCCTCCCCTGTGGGCTGTGGG + Intergenic
1064096368 10:12427335-12427357 GTGGCTGCCCAGAGGGAAGTGGG + Intronic
1065643180 10:27805644-27805666 CAGGCGCCCAGGAGGGCAGAAGG + Intergenic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067556382 10:47276235-47276257 CAGTCTCCCCAGGGAGCAGGAGG + Intergenic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1069565266 10:69459815-69459837 TGGGTACCCCAGAGGGCAGTGGG + Intronic
1069616275 10:69808306-69808328 GAGGCTTTCCAGAGAGCAGTGGG - Intronic
1070804173 10:79261104-79261126 CCGGCTCCCCCAAGGGTAGTTGG + Intronic
1071573004 10:86708244-86708266 CTGGCTGCCCAGCGGGGAGTGGG + Intronic
1071842304 10:89485142-89485164 TTGGCTCCCCAGAGGACATTTGG + Intronic
1072615416 10:97046365-97046387 CAGCCTGACCAGAGGGCAATGGG + Intronic
1075191619 10:120314931-120314953 CATGCTCCTCTGAGGGCTGTAGG + Intergenic
1075349244 10:121709106-121709128 CAGGCTCCGCAAGGGGCAGCCGG - Intergenic
1075581459 10:123621743-123621765 CAGCCTCCTGAGAAGGCAGTGGG + Intergenic
1076095623 10:127733274-127733296 TTGGCTCCACAGAGGACAGTTGG + Intergenic
1076680801 10:132170273-132170295 CAGGGTCCCCCGAGGGCGGCTGG + Intronic
1076880730 10:133238027-133238049 GAGGCTCCCCAGGGAGAAGTCGG - Exonic
1077034555 11:488402-488424 CATTCTCCCCGGGGGGCAGTGGG + Intronic
1077211103 11:1371321-1371343 CAGGCTCCCCGGGGGGCGGGCGG + Intergenic
1079454024 11:20621921-20621943 GAGGCGCCCCTGAGGGCAGGTGG - Intronic
1081663440 11:44902640-44902662 CTGCCCTCCCAGAGGGCAGTGGG - Intronic
1081702940 11:45163408-45163430 AGGGCTCCTCAGAAGGCAGTAGG - Intronic
1083170741 11:60922730-60922752 CAGGGTCCCCTGAGGCCTGTGGG + Exonic
1083894638 11:65613882-65613904 CTGGCTCCCCAGAGAGGCGTGGG - Exonic
1084215665 11:67645649-67645671 ACAGCTCCCCAGAGGGGAGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084529720 11:69719721-69719743 CAGCCTCTCCTGAGGCCAGTGGG + Intergenic
1084607563 11:70181311-70181333 CAGTCCCCACAGAGGGCAGGGGG + Intronic
1088875863 11:113935797-113935819 CAGGCTGCCCAGCGGGAGGTTGG + Intronic
1088919728 11:114252146-114252168 CATGGTCCCCAGAGGGCACTAGG + Intergenic
1089076356 11:115741836-115741858 AAGGCTTCCCAGAGAGGAGTAGG + Intergenic
1090356920 11:126146608-126146630 CGGGCTCCCCAGAGGGGACCTGG - Intergenic
1090718499 11:129451753-129451775 CTGGCTGCCCAGAGGTCAGGAGG - Exonic
1091640870 12:2236193-2236215 CAGGATCCCCAGATGGCTCTTGG - Intronic
1091998674 12:5015863-5015885 CTGGCTCACCTGAGGGCAGAGGG - Intergenic
1092360155 12:7829815-7829837 AAGGCACCCCTCAGGGCAGTAGG + Exonic
1092372810 12:7931294-7931316 AAGGCACCCCGCAGGGCAGTAGG + Exonic
1093809385 12:23473238-23473260 CTGGCTCCCCAGGGGTCAGAAGG + Intergenic
1096122043 12:49094585-49094607 CAGGCACCAGAGAGGGCAGCAGG + Exonic
1099556688 12:84117612-84117634 CAGGCTCCCCAAAAGTCAGATGG - Intergenic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1101304243 12:103511983-103512005 CACTCTCCCTAGAAGGCAGTTGG + Intergenic
1101843853 12:108346275-108346297 AGGGCTCACCAGAGAGCAGTGGG - Intergenic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102532001 12:113553498-113553520 CAGGAACCCCAGAGGGCTGAGGG + Intergenic
1103344751 12:120241762-120241784 CAGACTCCCCAGTGGGCCCTCGG - Intronic
1105474773 13:20720552-20720574 AAGGCACCGGAGAGGGCAGTGGG - Intronic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1110078910 13:71286562-71286584 GATGCTCCCTTGAGGGCAGTGGG + Intergenic
1112361092 13:98719261-98719283 CAGGAACCCCAAAGGCCAGTGGG + Exonic
1112437328 13:99399689-99399711 CAGAGTTCCCAGGGGGCAGTAGG - Intergenic
1113250634 13:108448781-108448803 CAGGCTACCCAGAGGGCTAAAGG + Intergenic
1113817063 13:113179745-113179767 CAGGGTCCCCAGGAGGCAGTGGG + Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114715016 14:24815879-24815901 CAGGCTCACCAGAGTGGAGGTGG + Intronic
1114860901 14:26520306-26520328 CAGGCTCCCCAGGGTGGACTGGG + Intronic
1119386954 14:74263391-74263413 GAGCTTCCGCAGAGGGCAGTAGG - Intergenic
1119524456 14:75311046-75311068 CAGGCAGCCCGGGGGGCAGTGGG + Intergenic
1121316151 14:92962080-92962102 CAGGCTCCACAGAGGACAGGTGG + Intronic
1121411644 14:93752549-93752571 CAGCCTCCTCAATGGGCAGTTGG + Intronic
1121518730 14:94571105-94571127 TGGGGTCCCCAGATGGCAGTGGG - Intronic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122274815 14:100586147-100586169 CAGGCTCCCACGAGGACTGTGGG - Intronic
1123018766 14:105387795-105387817 CTGGCTCGGCAGAGGGCAGGTGG + Intronic
1126309696 15:47301550-47301572 CAGGCTTCCCCCAGGGCAGCTGG - Intronic
1128080981 15:64856783-64856805 GGGGCTCTCCAGAGGTCAGTTGG + Intronic
1128212489 15:65912354-65912376 CAGGCTCTCCAGATTTCAGTAGG - Intronic
1128571189 15:68734329-68734351 ATGGCTTCCCAGAGGACAGTCGG + Intergenic
1128771594 15:70286718-70286740 CAGCCTCTACAGAGGGCACTTGG + Intergenic
1129119654 15:73388339-73388361 CAGGCTTCCCATGGGGCAGGTGG - Intergenic
1129226410 15:74172957-74172979 CTGGGTGCCCAGTGGGCAGTGGG + Intergenic
1129698174 15:77752481-77752503 CAGCCTCCCCACAGGGCTCTGGG + Intronic
1129705762 15:77793192-77793214 AAGGCTCCCCAGAGAGCAGAGGG + Intronic
1129885482 15:79034103-79034125 GAGGCTTCCCAGGGGGAAGTAGG - Intronic
1130538565 15:84804165-84804187 CTGCCTCCCCAGCTGGCAGTGGG + Exonic
1131441175 15:92460874-92460896 CAGGCTCCACACAGGGCACGAGG - Intronic
1132356168 15:101173051-101173073 CAGGCGCCCCTCAGTGCAGTAGG + Intergenic
1132457869 16:34022-34044 CAGGCTCCCCAGAGACAAGGTGG - Intergenic
1132533622 16:466544-466566 CGGGCTCCTCCGAGGGCAGCAGG - Intronic
1132973735 16:2701393-2701415 CAGGGTCCCCAGTGGTCAGCAGG + Intronic
1133035291 16:3030864-3030886 CTGGGTCCCCAGCGGGGAGTAGG - Intronic
1133597275 16:7304628-7304650 CGGGCTCCACAGAGAGCAGGAGG - Intronic
1135975245 16:27104451-27104473 CAGGCTCCACAGAGGGAATGAGG - Intergenic
1136045256 16:27610183-27610205 CAGGCCCCCCAGGTGGCAGCAGG + Intronic
1136153713 16:28368314-28368336 CGGGCTACCTAGAGGGCAGGGGG - Intergenic
1136209379 16:28746956-28746978 CGGGCTACCTAGAGGGCAGGGGG + Intergenic
1136226923 16:28865894-28865916 CAGACTCCGCAGAGAGCAATGGG - Intronic
1136580021 16:31145801-31145823 CTGGCTACCCAGAGGGCCGCAGG - Exonic
1137251404 16:46743522-46743544 CAGGCTCCCCATCAGGCTGTCGG - Intronic
1137547018 16:49411471-49411493 CAGCCTCCCCAGGGTGCATTAGG + Intergenic
1137618104 16:49858550-49858572 GAGGCTCCCCAGAGGGGCGGAGG + Intergenic
1137913622 16:52404636-52404658 CAGGCTTCTCAGAGGCAAGTGGG - Intergenic
1138100736 16:54250198-54250220 CAGGCTCCCAGAAGGGCAGGGGG - Intronic
1138128211 16:54456286-54456308 CCAGCTCCACAGAGCGCAGTGGG - Intergenic
1138132096 16:54488998-54489020 CAGGAACCCCAGGAGGCAGTAGG - Intergenic
1138655780 16:58490475-58490497 CAGGGTGCCCAGAGGGCATGAGG - Intronic
1139574327 16:67831697-67831719 CAGCCTCTCCAGAGGACAGGAGG + Intronic
1139583457 16:67886317-67886339 CAGGCTCTGCAGAGCGCAGCAGG + Exonic
1139911457 16:70399908-70399930 CAGGCTCCAGAGAGTGCTGTGGG - Exonic
1140454268 16:75095724-75095746 CCGGTTCTCCACAGGGCAGTGGG - Intronic
1141560810 16:84866635-84866657 CAGGCTGCCCAGAGGTTAGCAGG - Intronic
1141613621 16:85197861-85197883 CAGGGTCCCCACGGGGCTGTTGG + Intergenic
1141965132 16:87437011-87437033 TACGCTCCACAGAAGGCAGTGGG - Intronic
1142022311 16:87791540-87791562 GAGGCTCCCCAGAGGCTGGTGGG - Intergenic
1142169860 16:88616023-88616045 CAGCCTCCCCAGAGGAAAGCGGG + Intronic
1142396622 16:89835639-89835661 CTGACTCCTCAGAGGGCATTGGG + Intronic
1145013524 17:19382841-19382863 CAGGCACACCAAAGGGCAGTGGG + Exonic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1147054622 17:37824843-37824865 CCGGTTCCCCAGAGGCCACTTGG + Intergenic
1147165536 17:38591284-38591306 CAGGTTCCCCTGAGGGCCATGGG - Intronic
1148635275 17:49144348-49144370 AAGGCTCCCCAGAAGACAGATGG + Intronic
1148752266 17:49952057-49952079 CTGGCTCCCCAGAGTAGAGTAGG + Intergenic
1151543994 17:74780982-74781004 CCTGCCCCCCAGAGGACAGTAGG + Intronic
1152099816 17:78294488-78294510 CAGACTCCCCAGAGTACTGTAGG + Intergenic
1152961868 18:84725-84747 CAGGCTCCCCAGAGACAAGGTGG - Intergenic
1156481132 18:37437111-37437133 CAGGCTCCCCAGTGGGTGGCAGG + Intronic
1157288562 18:46393932-46393954 CAGGATCCCCACCAGGCAGTGGG - Intronic
1159001622 18:62980100-62980122 CAGGCTCCTCAGAGGGGAGGGGG - Exonic
1161340722 19:3740574-3740596 GAAGCTGCCCAGAGGGCCGTGGG + Exonic
1161352782 19:3803260-3803282 AAGCCTCCCCGGAGGGCAGGCGG - Intergenic
1161509325 19:4661909-4661931 CCAGCTCCCCAGAGGGCATCTGG - Intronic
1162142130 19:8591388-8591410 CAGGTTCCCCAGGAGGCAGCAGG + Intronic
1162455879 19:10784492-10784514 CAGGCTCCCTGGAGGCCAGCTGG - Intronic
1163117522 19:15197507-15197529 CAGCCTCCCGGGAGGGCAGCTGG + Exonic
1163119609 19:15209329-15209351 CTGGCTTCTCAGAGGGCAGGAGG + Intergenic
1163785974 19:19275114-19275136 AGGGCTGCCCAGAAGGCAGTGGG - Intergenic
1164726211 19:30467672-30467694 CTGGCTCTCCAGAGGCCAGCGGG + Intronic
1165108748 19:33489086-33489108 CAGGCTCTCCCGGGGGCTGTGGG + Intronic
1165154391 19:33778294-33778316 CAGCCTCCCCACCGCGCAGTCGG + Intergenic
1165636747 19:37346829-37346851 AAGGCTTCCCTGAGGGAAGTAGG - Intronic
1166956905 19:46470931-46470953 CAGGCATCCCAGAGGACTGTGGG - Exonic
1167528646 19:50001204-50001226 CAGGTTCCCCAGAGGAAAGCAGG - Intronic
1168294937 19:55373715-55373737 CATGCTCCCCAAAGTGCAGAAGG - Intergenic
1168726608 19:58586338-58586360 CAGGCTCCCCAGAGACAAGGTGG + Intergenic
924977661 2:192779-192801 CAGGCTACCCAGGGGAAAGTTGG + Intergenic
925104359 2:1277818-1277840 GTGGCTCCTCAGAGGGCAGCAGG + Intronic
925868997 2:8253180-8253202 CAGCCTCCCCAGAGTGCTGGAGG + Intergenic
926098569 2:10098590-10098612 CAGGGTCCCCAGAAGGCCGTGGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
927464066 2:23324003-23324025 CCTGCTCCCCACAGGGCACTGGG + Intergenic
929050598 2:37833649-37833671 CGGGCTCCACAGAGTGTAGTTGG - Intergenic
929243487 2:39676639-39676661 CAGGCTCCCCAGGAAGCACTTGG + Intronic
930215845 2:48696371-48696393 CAAGTTTCCCTGAGGGCAGTAGG + Intronic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931854879 2:66292613-66292635 CAGGCTCCTGAGAGGACAGGTGG + Intergenic
934502124 2:94869916-94869938 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
934559391 2:95304810-95304832 CTGGCTCCCCACAGGCCAGGAGG + Intronic
936061697 2:109299026-109299048 CAGGTGACCCAGAGGGCACTGGG - Intronic
936251946 2:110874076-110874098 GAGGATGCCCAGAGGGCAGGTGG + Intronic
936316581 2:111429447-111429469 CAGAGTCCACAGTGGGCAGTTGG + Intergenic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938229678 2:129647638-129647660 CAGGCTCCACACTGGGCACTGGG - Intergenic
938303085 2:130229768-130229790 CAGAGTCCCCAGAGGGCTGAAGG + Intergenic
938453586 2:131444458-131444480 CAGAGTCCCCAGAGGGCTGAAGG - Intergenic
941935171 2:170976069-170976091 CATGCCCCCCAGGGGGCGGTGGG - Intergenic
942437175 2:175991942-175991964 CATGCTCCCCGAAGGGCACTGGG - Intronic
944289745 2:197991868-197991890 CAGGCCCCACAGAAGACAGTGGG - Intronic
945864204 2:215158897-215158919 CAGGATACCCAGAGGACAGTAGG - Intergenic
946018479 2:216622689-216622711 CACACTCCCCTGGGGGCAGTGGG - Intergenic
946053816 2:216884466-216884488 CAGGCTCCTGAGAGAGCGGTTGG - Intergenic
947593916 2:231399352-231399374 CAGTCTCCCCAGAGGCCGGGCGG + Exonic
948422635 2:237869932-237869954 CAGGCTCCCCAGCACGCAGTGGG + Intronic
948564659 2:238876224-238876246 CAGCCTCTGCAGAGGGCACTAGG + Intronic
948619968 2:239228100-239228122 CAGGCACACCAGAGGGCACCAGG + Intronic
948752177 2:240139203-240139225 CGTGCTCCCCAGGGGGAAGTGGG + Exonic
949075925 2:242057852-242057874 GAGGCTTCCTAGAGGGCAGGGGG + Intergenic
1168822807 20:787164-787186 CAGACTCTCAAGAGGGCAATGGG + Intergenic
1169388995 20:5174256-5174278 CAGACTCCCAAGGGGACAGTTGG - Intronic
1169510854 20:6262236-6262258 CTGGCTCCCCAGCTGGCAGATGG + Intergenic
1170590148 20:17765451-17765473 CAGCCTCCGGAGAGGCCAGTAGG + Intergenic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172164638 20:32891685-32891707 CGGCCACCCCAGAGGGCTGTAGG - Intronic
1173571781 20:44081753-44081775 GAGCTTCCCCAGAGGGCCGTGGG - Intergenic
1175529117 20:59662136-59662158 CAGGCACCGCACAGGGCACTAGG + Intronic
1175794390 20:61762573-61762595 CAGGCTGGACAGAGTGCAGTGGG - Intronic
1175870499 20:62207316-62207338 GGAGCTCGCCAGAGGGCAGTGGG - Intergenic
1176097957 20:63352901-63352923 AAGGCTCCCCAGAGGGCGGCTGG - Intronic
1176112374 20:63416460-63416482 CTGGCTCCCTTGAGGACAGTGGG + Intronic
1176134874 20:63518122-63518144 CAGGCTTCCCACAGGGCGGGAGG - Intergenic
1176623884 21:9075249-9075271 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1176956050 21:15105281-15105303 AAGGCTGCCCCAAGGGCAGTGGG + Intergenic
1178263559 21:31121749-31121771 CTGGCTTCCTAGAGGGCAGTAGG - Intronic
1178733918 21:35131667-35131689 CAGGCTTCCCTGAGAGCAGATGG + Intronic
1178853195 21:36230218-36230240 CAGCCTCCCCAGAGAGCATGTGG + Intronic
1179332302 21:40415729-40415751 CAGGCTCCCCAGGGGGCCGGTGG + Intronic
1180731742 22:17987498-17987520 TAGGCTGCCCAGGGGGCAGAAGG - Intronic
1180824465 22:18853157-18853179 CAGGCTCCCCAGTGAGCTGCGGG + Intronic
1181188269 22:21121391-21121413 CAGGCTCCCCAGTGAGCTGCGGG - Intergenic
1181210929 22:21289102-21289124 CAGGCTCCCCAGTGAGCTGCGGG + Intergenic
1181228022 22:21403528-21403550 AAGGCTCCCCAGAGAAAAGTAGG + Intergenic
1181398576 22:22637786-22637808 CAGGCTCCCCAGTGAGCTGCGGG - Intergenic
1181482959 22:23212540-23212562 CAGGCCCCACAGAGCCCAGTGGG - Intronic
1181610115 22:24006469-24006491 GAGTCCCCCCAGAGGGCAGGTGG + Intergenic
1181650840 22:24258274-24258296 CAGGCTCCCCAGTGAGCTGTAGG + Intergenic
1181706541 22:24652465-24652487 CAGGCTCCCCAGTGAGCTGTGGG - Intergenic
1181711828 22:24696064-24696086 CAGGCACCCCAGAGGGAGGGAGG - Intergenic
1181987542 22:26810958-26810980 CAAGGACCACAGAGGGCAGTGGG - Intergenic
1182150181 22:28022133-28022155 TCGGCTCCCCAGAGAGCAGAGGG - Intronic
1183406321 22:37632308-37632330 CAGGATCCCCGGAGGGGAGCTGG + Intronic
1183428672 22:37752746-37752768 CAGGGTCCCCGGAGGGCAGAGGG + Intronic
1184859467 22:47165045-47165067 CAGCCTCTCCACAGGGCAGGGGG + Intronic
1203216018 22_KI270731v1_random:6328-6350 CAGGCTCCCCAGTGAGCTGCGGG - Intergenic
1203274604 22_KI270734v1_random:79062-79084 CAGGCTCCCCAGTGAGCTGCGGG + Intergenic
949397351 3:3629153-3629175 CAGACTCCCCAGAGGACAGTTGG + Intergenic
949506925 3:4737337-4737359 CAGGCTCCCCAGAGAGATGCTGG - Intronic
950040694 3:9917407-9917429 CAGACTCACCGGAGAGCAGTGGG - Exonic
950452312 3:13072327-13072349 CAGGCTTCCCAGGGGGCAGTGGG - Intronic
952320836 3:32276314-32276336 GCAGCTCCCTAGAGGGCAGTGGG + Intronic
953847092 3:46436214-46436236 CAGGCTTCCAGGAGGGCTGTGGG + Exonic
953979579 3:47406942-47406964 CAGGCTCCCTACAGAGCAGGTGG + Intronic
954443253 3:50533304-50533326 CATGCTCCCCTGAGGCCGGTGGG + Intergenic
954762973 3:52890425-52890447 TTGGCCCCCCAGGGGGCAGTTGG + Intronic
959350473 3:105255904-105255926 CAGGCTCCCCAGGGGACAGTTGG - Intergenic
959652926 3:108769371-108769393 CAGACTCCACAAAGAGCAGTTGG - Intergenic
960969528 3:123129755-123129777 CAGGCTCCAGAGAGGTCAGGCGG + Intronic
961174507 3:124822752-124822774 CAGGCCCCACAGAAGGCACTGGG + Intronic
961330763 3:126136678-126136700 CAGGACCCCCAGAGGCCAGTGGG + Intronic
961446964 3:126985436-126985458 CTGGCTGTGCAGAGGGCAGTAGG - Intergenic
961620800 3:128223036-128223058 CCAGCTCCCCAGAGGTCAGGAGG - Intronic
961650212 3:128413404-128413426 CAGGGACCTCAGAGGGCACTGGG + Intergenic
961661864 3:128473306-128473328 CAGGCTCCCCAGGGGACCCTGGG - Intergenic
963799105 3:149658880-149658902 CAGGCTCCCCGGAGGGCGGCAGG - Intronic
964254947 3:154765912-154765934 CAGCTTCCCCAGAGGGCACCTGG + Intergenic
967668962 3:192209366-192209388 CAGGATTCCCAGAGGACACTAGG - Intronic
968047270 3:195631360-195631382 CAGCCTCACCCAAGGGCAGTTGG + Intergenic
968307343 3:197658564-197658586 CAGCCTCACCCAAGGGCAGTTGG - Intergenic
968565250 4:1309312-1309334 CAGGCTCCTTAAAGGGCATTTGG - Intronic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
969252447 4:5977023-5977045 CGGTCTCCCCAGAGGGCACCTGG - Intronic
969411799 4:7033452-7033474 CTGTCTCCCCAGCAGGCAGTGGG + Intergenic
969603011 4:8188280-8188302 TGGGCTCTCTAGAGGGCAGTAGG + Intronic
969676434 4:8616873-8616895 CACGAGCCCCAGAGGGCAGGGGG + Intronic
970629559 4:17925436-17925458 CAGGCACCTCAGTGGGCTGTGGG - Intronic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
972708048 4:41564909-41564931 CAAACTCCTCACAGGGCAGTAGG - Intronic
972945451 4:44248850-44248872 CAGGTTCTCCAGAGGGGAGGAGG - Intronic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
975794734 4:77995119-77995141 AAGGCTCCACAGAGCACAGTTGG - Intergenic
979301822 4:119095279-119095301 CAGCCTCCTTAGAAGGCAGTGGG + Intergenic
980745471 4:137007364-137007386 CACCCTCCCCAGAGGCCAGGAGG - Intergenic
981710936 4:147708341-147708363 CAGGCCCCCTAGTGGGCATTTGG - Intergenic
981753894 4:148120092-148120114 CATCTTCCCCATAGGGCAGTAGG - Intronic
982156130 4:152522684-152522706 CAGGGTCCCCAGGGGACATTTGG - Intronic
984988354 4:185352909-185352931 CAGTCTCCCCAGAAGGCAGTGGG + Intronic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985692092 5:1319193-1319215 CAGGCTCTGCAGGGGGCAGGCGG + Intronic
985981937 5:3477338-3477360 CGGGGTCCCCTGAGGGCAGCTGG + Intergenic
986141288 5:5033112-5033134 AAGGCTGCCCAGAAGGCAGCAGG + Intergenic
986336581 5:6759935-6759957 CAGGCCCCCGAGAGGGCGCTGGG + Intergenic
988771691 5:34439297-34439319 CAGGCACTTCAGAGGGCACTTGG - Intergenic
997157214 5:131573585-131573607 CAGGCTTCCAAGAGGGCACCAGG + Intronic
997954017 5:138264399-138264421 AAGGCTCCTCTGAGGGCAGTGGG + Exonic
998166339 5:139846554-139846576 CAGGTTCCCCAGCAGCCAGTGGG + Intergenic
1001209313 5:169795416-169795438 GAGGCTCGCCAGAGGGCTGCAGG + Intronic
1002092931 5:176815363-176815385 GAGACTCCCCAGAAGGCAGGAGG - Intronic
1003129961 6:3386880-3386902 CAGGCACCCCAGGGTGCAGCAGG + Intronic
1004320236 6:14626214-14626236 CCTGCACCCCAGAAGGCAGTGGG - Intergenic
1004702025 6:18088200-18088222 CAGGCCCACCAGAGAACAGTGGG + Intergenic
1005825860 6:29631655-29631677 CAGGCTCCCCAGTGGGAGGAAGG + Intronic
1005840932 6:29744258-29744280 CAGGCTCACCAGAGGGCACAGGG + Intergenic
1005922789 6:30416376-30416398 CAGGCTCACCAGAGGACACCAGG - Intergenic
1006059951 6:31412212-31412234 TAGGCTCACCAGAGGGCACAGGG - Exonic
1006072440 6:31507287-31507309 CAGGCTCACCAGAGGGCACAGGG - Exonic
1006146842 6:31964393-31964415 GGGGCTGCCCAGAGGGCAGAGGG + Intronic
1006411315 6:33875546-33875568 CTGGCTTCCCAGAGGGCCGAGGG + Intergenic
1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG + Intergenic
1007109225 6:39303524-39303546 CAGCCTCCCCAGAGCCCTGTGGG - Intronic
1007210481 6:40189869-40189891 CAAGCTCCACAAAGGGCAGATGG + Intergenic
1014724893 6:124962381-124962403 CGGGCTCCCCGGAGGGGACTTGG + Intergenic
1015604061 6:134937693-134937715 CAGGTTCCCCAGAGTGGACTAGG - Intronic
1015837124 6:137432506-137432528 CAAGCTCAGCAGAGGGGAGTTGG + Intergenic
1017022209 6:150149364-150149386 CAGGCTAGCTAGAGTGCAGTGGG + Intronic
1018499974 6:164396680-164396702 CAAGCCCCTCAGAGGGCAGAGGG - Intergenic
1019319775 7:410316-410338 CTGGCCCCCAAGAGGACAGTCGG + Intergenic
1023025597 7:36047161-36047183 CAGGCTTCCCTGAGAGCAGTAGG - Intergenic
1026298811 7:69079344-69079366 CAGTCTACCCGGAGGGCAGAAGG - Intergenic
1028094672 7:86745237-86745259 CAGAAACCCCTGAGGGCAGTGGG + Intronic
1029403234 7:100358171-100358193 GAGGCTCCCCAGAGGGCTGTGGG - Intronic
1029405806 7:100373525-100373547 CAGGCTCCGAAGAGGGCTGTGGG - Exonic
1029993737 7:104986110-104986132 CAGGATACCCTGAAGGCAGTAGG + Intergenic
1032414397 7:131725221-131725243 GAGGCTCTGCAGAGGGCAGGGGG + Intergenic
1034274238 7:149817058-149817080 CAGGCTCCCCAGAGCAGAGCTGG - Intergenic
1035281711 7:157782623-157782645 CAGGGACCCCTGGGGGCAGTTGG - Intronic
1035334887 7:158121484-158121506 TATGCTCCGCAGGGGGCAGTAGG - Intronic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1035670337 8:1412176-1412198 GGGGCTCTGCAGAGGGCAGTGGG - Intergenic
1037905476 8:22713745-22713767 CCTGCTCCCCAGAGGGCAATGGG + Intronic
1038049864 8:23798457-23798479 CAGGCTCCCCAGAGGGCTCGAGG + Intergenic
1038976613 8:32704186-32704208 CGGCCTCCCCAGAGGACATTGGG - Intronic
1039894578 8:41707427-41707449 CAGGCTGCCCAGAGGCTTGTGGG + Intronic
1043538074 8:81227934-81227956 CCTGCTCCCCAGTGGACAGTAGG - Intergenic
1043890061 8:85644356-85644378 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043891602 8:85656270-85656292 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892674 8:85663107-85663129 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892883 8:85714228-85714250 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043895570 8:85735682-85735704 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043897109 8:85746126-85746148 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043899435 8:85764494-85764516 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043901043 8:85776687-85776709 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043903007 8:85791962-85791984 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043904617 8:85804155-85804177 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043906229 8:85816346-85816368 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043907837 8:85828536-85828558 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1044854487 8:96461002-96461024 CAGGCTCACCAGAAAGCAGGTGG + Intergenic
1046981891 8:120345442-120345464 CAGGCTCCCCAGGAGGCCCTTGG - Exonic
1047311216 8:123694030-123694052 CAGTCTGCTCAGAGGTCAGTGGG - Intronic
1048211929 8:132461593-132461615 CAGGCACCCTGGAAGGCAGTGGG - Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1048993311 8:139774055-139774077 CAGGCTGCTGAGAGCGCAGTGGG + Intronic
1049206585 8:141366451-141366473 CAGGGTCCCGAGGGGGCAGCGGG - Intronic
1049425913 8:142537796-142537818 GAGGCTCCACAGGGGGCTGTTGG - Intronic
1049544134 8:143221674-143221696 CGCGCTCCCCAGACGGCAGGCGG - Intergenic
1051691311 9:19715680-19715702 CATGCTCCTCAGAGGGCTGGAGG + Intronic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1055977838 9:81971956-81971978 CAGGCTCACTAGAGGGCAGCAGG - Intergenic
1059320431 9:113464300-113464322 CAGCCTCCCCACAAGGCAGCAGG - Intronic
1059535147 9:115073738-115073760 CAGTCTCCCCACAGGCCAGTGGG - Exonic
1059970261 9:119660108-119660130 CTGCCTCCCCATAGGGCTGTAGG + Intergenic
1060257691 9:122047096-122047118 CAGGCTCCCCAGATGTGACTAGG - Intronic
1061812115 9:133168163-133168185 CAGGCTCCCCTGAGAGCAGAAGG + Intergenic
1062207231 9:135343901-135343923 CCGGCTCCACAGAGGGGAGGGGG + Intronic
1062567770 9:137170887-137170909 CAGGCCCTCCTGAGGGCAGCTGG - Intronic
1062584261 9:137241850-137241872 CGGGGTCCCCGGAGGGCGGTCGG - Intronic
1062736275 9:138139379-138139401 CAGGCTCCCCAGAGACAAGGTGG + Intergenic
1203747069 Un_GL000218v1:45677-45699 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1203563036 Un_KI270744v1:73803-73825 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
1186295058 X:8140439-8140461 CAACCTCCCCAGAAGGCATTTGG + Intergenic
1189993208 X:46613832-46613854 CACTCTACCCAGAGGGCAGGTGG + Intronic
1192764673 X:74128804-74128826 CAGGCCTCCAAGAGGGCACTAGG - Intergenic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic
1200110204 X:153737085-153737107 CAGACTCCCCAGAATGCAGAGGG + Intronic
1200398509 X:156005461-156005483 CAGGCTCCCCAGAGACAAGGTGG + Exonic
1200983751 Y:9285572-9285594 CAGGCTCACCCCATGGCAGTTGG - Intergenic
1201160390 Y:11160672-11160694 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1201866260 Y:18658741-18658763 GAGGATCCCCTGAGGCCAGTGGG + Intergenic
1202269708 Y:23060106-23060128 CAGGGACCTCAGAGGGCATTAGG + Intergenic
1202422702 Y:24693852-24693874 CAGGGACCTCAGAGGGCATTAGG + Intergenic
1202448087 Y:24976234-24976256 CAGGGACCTCAGAGGGCATTAGG - Intergenic