ID: 1196820662

View in Genome Browser
Species Human (GRCh38)
Location X:119697859-119697881
Sequence ATATTGAAGGAGAAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196820655_1196820662 18 Left 1196820655 X:119697818-119697840 CCCTGATGGGTTGGGATACAGGA No data
Right 1196820662 X:119697859-119697881 ATATTGAAGGAGAAGTTTGAAGG No data
1196820656_1196820662 17 Left 1196820656 X:119697819-119697841 CCTGATGGGTTGGGATACAGGAC No data
Right 1196820662 X:119697859-119697881 ATATTGAAGGAGAAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196820662 Original CRISPR ATATTGAAGGAGAAGTTTGA AGG Intergenic
No off target data available for this crispr