ID: 1196821404

View in Genome Browser
Species Human (GRCh38)
Location X:119703985-119704007
Sequence AGGAAAAAACAGATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196821404_1196821413 24 Left 1196821404 X:119703985-119704007 CCCAGCTTCATCTGTTTTTTCCT No data
Right 1196821413 X:119704032-119704054 GATGATGCCCACATTGGGGAAGG No data
1196821404_1196821412 20 Left 1196821404 X:119703985-119704007 CCCAGCTTCATCTGTTTTTTCCT No data
Right 1196821412 X:119704028-119704050 ATTAGATGATGCCCACATTGGGG No data
1196821404_1196821410 18 Left 1196821404 X:119703985-119704007 CCCAGCTTCATCTGTTTTTTCCT No data
Right 1196821410 X:119704026-119704048 AGATTAGATGATGCCCACATTGG No data
1196821404_1196821411 19 Left 1196821404 X:119703985-119704007 CCCAGCTTCATCTGTTTTTTCCT No data
Right 1196821411 X:119704027-119704049 GATTAGATGATGCCCACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196821404 Original CRISPR AGGAAAAAACAGATGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr