ID: 1196821593

View in Genome Browser
Species Human (GRCh38)
Location X:119705587-119705609
Sequence AAACTCAACATGTCCCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196821593_1196821596 2 Left 1196821593 X:119705587-119705609 CCAGTTTGGGACATGTTGAGTTT No data
Right 1196821596 X:119705612-119705634 GAAGCTTTTGAGGCATTGAAGGG No data
1196821593_1196821595 1 Left 1196821593 X:119705587-119705609 CCAGTTTGGGACATGTTGAGTTT No data
Right 1196821595 X:119705611-119705633 AGAAGCTTTTGAGGCATTGAAGG No data
1196821593_1196821594 -8 Left 1196821593 X:119705587-119705609 CCAGTTTGGGACATGTTGAGTTT No data
Right 1196821594 X:119705602-119705624 TTGAGTTTGAGAAGCTTTTGAGG No data
1196821593_1196821597 3 Left 1196821593 X:119705587-119705609 CCAGTTTGGGACATGTTGAGTTT No data
Right 1196821597 X:119705613-119705635 AAGCTTTTGAGGCATTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196821593 Original CRISPR AAACTCAACATGTCCCAAAC TGG (reversed) Intergenic
No off target data available for this crispr