ID: 1196821596

View in Genome Browser
Species Human (GRCh38)
Location X:119705612-119705634
Sequence GAAGCTTTTGAGGCATTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196821593_1196821596 2 Left 1196821593 X:119705587-119705609 CCAGTTTGGGACATGTTGAGTTT No data
Right 1196821596 X:119705612-119705634 GAAGCTTTTGAGGCATTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196821596 Original CRISPR GAAGCTTTTGAGGCATTGAA GGG Intergenic
No off target data available for this crispr